Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:301G8   

TH:301G8RNAiTH:301G8
PCR_productTH:301G8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F09F7.3 Source_evidenceePCR1462WS150 Sequence/Annotation Release
Chunk_score Abs_score1378
Max_abs_score1378F09F7.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII55584785560697
Overlaps_transcript F09F7.3.1 Source_evidenceePCR1462WS150 Sequence/Annotation Release
F09F7.3.2 Source_evidenceePCR1462WS150 Sequence/Annotation Release
WB_DNA_textTH:301G82220atcagattttgacattgtgagtacaatcggtcacgaggagaagtacgtttcagcatttgctcaaactctcgaagaatccataaatgccggagtttatacccaacagcaggcactcgcatatgttacctcaaaagtcaaggctcgtaaattcacaccattcggatcacttccaggaacttcagtgagcgtcttgactccaccgaaagaacacgaagcagtcgattttctgtccaattcaatgatcacacatattgcttgcccagatggaaatttcaaaatgaaggcgatttatttgggattaatgacaagacgactgattcaaacggaactcggagaaaatgggcttgatgatcgggatttctacggaaataaacgtttggagctcgctggatcattgctttcgttgctgtttgaggatgtattcaaaagattcaactctgaactgaaaagaattgcagacaatgcgttgatgaagacaatggctgcaccattggatattgtgaagcatatgagacaagatatgattacgaatactatagtgaatgctatgtcgacaggaaattggattatcaaaagattccgaatggaacgacttggtgttacacaagtactaagtagattgtcatatatctcagcacttggtatgatgacaagaatcaactcgacttttgagaaaactcgaaaagtctctggtcctcgatcccttcaaccatctcaatggggaatgctttgtccgagtgatactcctgaaggtgaagcttgtggtcttgtgaagaatctcgctttgattagtcacattacaactgattccgatgagaaacccgttctcagattgttactcaattcgggagtcgaggatttacataatgtgcatttctcgcatgtcaataagccgtgagtttttacaaattaaaattttaagtgtgaaatcttgaaaaataaaagttttgagaatgctagttttgaaaaaatcgcatattttaatcaatttttataaatttctaaaataaattatcaatttcataaaaattagatttcaaatcgagttaaggtttgacaatttttgaaaattactagatccatttttttgtgttttttcctaaaaaaaaggttatttttatcgaaaattttcagtgaaaacacgttgatcttcttaaacggagtgctcattggaacagctgtggatccagaaagagtggtgaaagccgtcagagatttgagaaggtttcaacaaaaaaatgttgccaaaaaattcatcgaatttcaatttcagaagtggactcctgtcagaatttgtttcagtatcccgttctctaaccaatcgttctgttttcatttcatcagacggtggccgcctgtgtcgaccatatattattgtcaaaaacggaactccaatgctcacacaggctcacgtgcaggaactgaaagagggaaaaatgatttttgaggattttgttgatgacggaattgtcgaatatttggatgtaaatgagatgaacgatgcgttgattgccgtttatgggagagaaattggcccagaaactacacatttggaggtacgtttttgaactttgtgaatctaaaaatgaaaaaaattaaatcgaaaactggttgttctttcctgtaaagaaaattcaaaaaatttggtaaaatttgtctgaaacttaaaactatgtgaaaaaagtttaaattctcatttttttaaatataaaaaattgaaaatcaaattatttagagctctaaaattctataattcaaggaaattccaacatttaaagatttttatccttagtttaaaataaaatttgcacttttcagtgtctgagctattaataatctttcaaaatttccagattgagccatttactcttcttggagtgtgtgctggtcttattccatatccacatcataatcaatctccacgtaatacttatcaatgtgctatgggtaaacaagcaatgggaacaattgcctataatcaacagaaaagaattgattcaattatgtatcttttatgttatccacagagaccactcgttaagtcaaaggttcgttaaaattgaaatattttaaaatttatgaaaaaaatttgattaaaaaatgcatgtttcatttattgaactaatgtttgtggagagatatcgttaataatcctgaaaataaaaataaatcaatttcctgaattccgaaaaataaaaaaatcaaatcggaagtatccgc