Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:301e11   

TH:301e11RNAiTH:301e11
PCR_productTH:301e11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF25B5.4c Source_evidenceePCR297WS150 Sequence/Annotation Release
Overlaps_Gene F25B5.4 Source_evidenceePCR1280WS150 Sequence/Annotation Release
Chunk_score Abs_score1607
Max_abs_score1607F25B5.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII59423615943738
Overlaps_transcript F25B5.4c Source_evidenceePCR297WS150 Sequence/Annotation Release
F25B5.4a.3 Source_evidenceePCR1197WS150 Sequence/Annotation Release
F25B5.4a.2 Source_evidenceePCR1280WS150 Sequence/Annotation Release
F25B5.4a.1 Source_evidenceePCR1280WS150 Sequence/Annotation Release
WB_DNA_textTH:301e111378atccagaaggaatcaactcttcatttggttctccgtttgagaggaggtatgcaaatcttcgtgaagactttgactggaaagactatcaccctcgaagtcgaagcctctgataccatcgaaaatgtgaaggccaagatccaagacaaggaaggaatcccaccagatcagcagcgtcttatctttgccggtacgttatatagatatacataactcaaatcaactattattatttcaggaaagcaattggaagatgggcgcacgctctctgattacaacattcagaaggaatctactcttcacttggttctccgtctccgaggaggaatgcagatcttcgtcaagactcttacaggaaagaccatcacgctcgaggtggaagcttctgacactattgagaacgtgaaggccaagatccaagacaaagaaggtatcccaccagatcagcaacgcttgatcttcgccggaaagcaactcgaggatggccgtaccctttcggactacaatatccagaaggaatcaaccctccatttggtgctccgtctcagaggaggtatgcagatcttcgtcaagacattgactggaaagaccatcacacttgaagtcgaagcctctgataccatcgagaatgtgaaggccaagattcaagacaaggaaggaatcccaccagatcagcagagactcatcttcgccggaaaacaactcgaagacggtcgtaccctctccgactacaacatccaaaaggagtctactcttcatttggttctccgtctgagaggaggtatgcagatcttcgtcaagacattgaccggaaagaccatcaccctcgaagtcgaagcctccgacaccatcgaaaatgtcaaggccaagatccaagacaaggaaggaattccaccagatcagcagagacttattttcgctggtgagttcatattgtttttagaattaaaactaatttttattgtttttcaggaaagcaactcgaggatggccgtaccctttcggactacaatatccagaaggagtctactcttcatttggtgctccgtctcagaggaggtatgcagatcttcgtcaagactttgactggaaaaaccatcactctcgaggtcgaagcttcggacaccattgagaatgtcaaagccaaaatccaggataaggagggaatcccaccagatcagcaacgtttgatctttgctggaaagcagctcgaggatggacgcactctatccgattacaacatccaaaaggagtcgacacttcatctcgttcttcgtcttcgcggaggagacatttaaatcgaacccatcaattcactcgttattcctcctcgatctccgttcaagtaacaattatttattctttattccttcgggaattt