Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302A1   

TH:302A1RNAiTH:302A1
PCR_productTH:302A1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST12A2.3 Source_evidenceePCR621WS150 Sequence/Annotation Release
Overlaps_Gene T12A2.3 Source_evidenceePCR753WS150 Sequence/Annotation Release
Chunk_score Abs_score711
Max_abs_score711T12A2.3
Specificity_index0.854
Rel_score1
Map_statusUnique_ePCRIII62405166241560
Y70G10A.1 Chunk_score Abs_score122
Specificity_index0.146
Rel_score0.172
Overlaps_transcriptT12A2.3 Source_evidenceePCR753WS150 Sequence/Annotation Release
WB_DNA_textTH:302A11045cgagcgtttatgatgagattatccggttgccattagaatagtcattcattctacattttcagtcagctggaggtctcacctcttgtctttctttgtcttttccatatcaaactccctttcccttgtttgaatgattatgtattttgaggttcatcgaactttgtctgacttgcattttctttgctgctctttatcttttaattcttcattttattctagtaattctcagcacttctttgcacaacctcaaaatgtcgttcaccccggagctcaatatggcagtctgcgaattcaatttggattcaggatgcaatgccaaagaatcgctcattgaaatggcgaacaacaagatctcattggaaactttcaaagagcacaatatcaaggcactcaccatgaaatatgtcaactcagagagtatgatgtgggaagcaagaaaaattgttagaattatttctcgccttgaagcggatgaacatcagtccagagttgctccaaaaaggtcaagaagtcctggatctacatccccatctgcatcgaactcttcatcttcttcaagtgaactctcatttgatatgttctcgtctaaaagaaccgtcccaatgaaagtcacttcaaagccaaaaagagtgattgctcaagcttcacggaccatgaagccacatcagcaagagtctcgtcaagaatccgctgaaaaagatcgagccaatgatgagaagttgaaaaagttcattgagagcagaaaactgaaagagcaagcaaagaaggctgcaaacatccaaaaatgcaacgaagtaaaggaagctgtcatgtttccagccaagagaatgaagaaacgtcagctcgagcagtacgcctacagattcaagtaatctaattgtgttcctacgttacctaactattcatcttatcaaatatttttctaatttccaaaattactaattattttgtaccgggtttatattgtcaataattgtgtgctttaataaaattttgtaccttacatgtgaaagtgtcatgtgggttttgcgagtggtgagaatct