Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302B10   

TH:302B10RNAiTH:302B10
PCR_productTH:302B10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K06H7.4 Source_evidenceePCR1163WS150 Sequence/Annotation Release
Chunk_score Abs_score1018
Max_abs_score1018K06H7.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII80856728087961
Overlaps_transcript K06H7.4.2 Source_evidenceePCR1163WS150 Sequence/Annotation Release
K06H7.4.1 Source_evidenceePCR1163WS150 Sequence/Annotation Release
WB_DNA_textTH:302B102290atgtcatcgcggtattcaggtttgtacacttgagtattaaagcaaatttcaacgcttttgataatttcagaacgaaatggactatcggagacggagaagatgactcttcccaaagtacgcaagaggaaggcacaacttgtcgatgaaattgaggcgctaaaaaatgaggtgtgaaaactaattagttttaatgaatgttttagccaaacaaaaatctttagaacggaaatcttcacttttctattttaaataatatttttcaaaattatattaatcaattctctgtgatgccttttacggttttgtttttgcattctaaaaatttagatttttgttataaatatcgaagaatatttctaataactgaaactttgataagctatctttgatttctaaaaaaaacaataaatttaaaaaagcaaaatgacgttctccatgtgtgctattttaaattctgtctattacgaaatatgtcaacatattaggtacgagaagttgacgaagaactcgatcaagtatattacacccatccaaaatcaaaagaatatcacaaaatagtggtgaatggccgaaaaaagttcaatcaagacccatggaaagcgttggattggttggcatcaagaaatgtagttgcaaaggatcctcaagcattggcgctctggatgaaagctgtgagttttcttattttttaaaacaattatttaatagaaatctatttattatgttttcaactgcaatttttcagggcgaaggactttctaaaagtgcgatcggcgaaatactgggtgataaccgtccatttgcgttggaaacccttgacagattcacaaaagaacataaattgcatgatgttccgattgttccagctcttcgtcaatatctattttccttccggctacctggcgaatcgcagaaaattaatcgaattttggagaaatttgcagaagtttacgcgaatcaaaatccatcatatggaaatgcagatcaagcacatacagtagcatattcatgtattatggttaatacattattacataatccaaacgttaaagataaaccatcactggaaaaatatattgaaatgaatgaggttggtataggatgaaaattgaagaaaaaacatttttaatgaaattaaatggaaaatttcagcaacttctcgaaaaaggtgcaattacaatcgaacagctcacagaagtatatgaatcagttagtgttacacaattcaagatcccagatgaagtatcgacaagtggaaaaggaactgtgaacgatattctattacatgctgaacgagaaggatggcttttcaagcagagtagtaatccattattttctggtgctctttcgtggaaaaaacgatggtaaggttttgaatatatttattagtagcatactttttaaagatggaaccgtataaccgaaatataactgtttaaaaaattattagttttctactaaatattatgattttttaaattttgcaaaaataggaaaggctaaatttgaattccgttttcagactaaatttattgattttggtgattttttctcggatattcgattaaaagctcgcttttccaatttttaaaaaacaatttctccgttaaaaaacttgataaccagaaagaatattggattaaaaatcgattttttgatagttttttttttgtaaaaatgtgtgtaaaaatttaacattcggttttaaccagaaaacgcaaaaatggcgaaaaacttttttcttttgcaaaattgaaaaaatcattttaaaatgtttaaaaaaattttattgcaatttttttaaataataaaaatgttttttcggtcattgaggtcaatatgtatcttttaaaagaaactcctcatccgaatatactacactttaaaccatttttcacattgtttcatgaacacaaataatccttaactttattataggtttgttctttctgagaattgtctctactactttgaccaaatgactgataaggaaccaaagggaatcatcacattggcaaatgttggaatacggaaggtcgaggcaccctccaggccattcatgtttgaggtttaaattgctgaattaaatttcaaagttaatttttcttgaattccagatattctctctatcggatggacaaatcaaagcatgcaaaacagaacaagatgggcggcttgtcgaaggacgtcattcgatttacaaaatatgtgcagtaaatgatgaagatatgagatcatggatcaacgcaatatcacgaatgatggcaccgcagcaacatttattagccag