Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302B2   

TH:302B2RNAiTH:302B2
PCR_productTH:302B2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26A5.4 Source_evidenceePCR1429WS150 Sequence/Annotation Release
Overlaps_Gene T26A5.4 Source_evidenceePCR1452WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII64601366462146
Overlaps_transcriptT26A5.4 Source_evidenceePCR1452WS150 Sequence/Annotation Release
WB_DNA_textTH:302B22011agtttagaagtgaagccgcagtcgtcgttcttggtgatgtcggcagaagcccacgaatgtgtaatcacgcaaaaatgctcgctgatgaaggatttgatgtcaaacttattggatttttcgattctattccaggagaacaaattatgaatcatccaaggataaagtgagtttcagaaaatttttatctaaaaaatttgcaaaaaagttgttccgtttaaaaaaataaatttagttacaaatcatccaaagaatttttccaaataaataaaatttcagaatagttggaatcccgccacctcctgacttcatggattcgttaccagctttcgtgcaacttccactgaaacttttttggaactttataactcttttcttggctctcgcttttcaaacaagcgcctttaatttaagaattattcttatgcagaatccgccggcgcttccgacgatgatagtttgtttcatggtaggattctactgactaccgttataaaatatcaactttaatttcagttttccatattcaaattcgcaaaattctcaattgattggcacaattacatgtattcaattctacaaaataaataccaattgaccgatgatcaagtttttggaaacgataaaaaaaccaaaaaagcccagtgagtattggacaccggcattgttccccgacgcgaaaaaaaacagtcggtactcggtctccacacgacaaatctttgtgaaacgaagaatgacatacgcctttaaagagtactgtaatttatcccatgaaaaatattttttacgaaaactggaaaaatcacatcaaactgttgcagcaacgaatttgaaactatagtactcttcaaaggcgcataacctttcatatttaacgaaaacttgtcgtgccgagaccgggcaacgtattttagccaaaacattcgcgtctgtacaataaatcaaactcgtattgaacaatttacattttcagaattgtgagatgtgttggattcctagaaggtctatgtggaaaactatccgattataatctgtgtgtaacaaatgccatgcgtcgagatctcatggatcgatggggcatcagagccagcacattctatgataggccgccgacgtggaaatttaggtttgaacaaatgtgaaatttctgaaaattaatctcgaaattttcagagacacaacaatacaagagatccatgatttgtatctaagactttcacaaaaggaacgaattctacaaggaaaagacgaagactccacaattctgactcataaatcttcgaacggagtagtgcagctactaacaactcgacccattgtgtttctctcttccacatcctggacacctgatgaacggtttgaaattcttctcgatgcgctggttgcatatgacaaaacaatcggactcccgcgagttttgatgattatcactggaaaaggtccactgaaagcgaaatatttacaagaaattcacgagaaaaatctgaagaatgtcgatgtattgactccatggttggaagcagaagattatccaaagattctagcctctgctgacttaggaatctctttgcacacaagcacgtctggattggatcttccgatgaaagttgttgatatgtttggagctaaagttccagcattggctctaaaattcaaatgtattgatgagctcgttgaggagaaaactaatggatatcttttcgatgattctgagcagttgagtcgtcaaattattgaactttctcgtggattcccaaataattgcaatgaattgatacggctcaagaagaatacacaggagcaaaaattcgattcttgggaagtgatgtggaagagatcagctacctctggtgcagactttcgagttccagacaatggattcgccaaacttcgtgcaattattcaattctcatttttcgctattttattgatcatgccgattcacttatttatgggcactttttcgggggcattcagatcgctttaattttttttcggggttttgtacattcaa