Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302E9   

TH:302E9RNAiTH:302E9
PCR_productTH:302E9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06G4.2d Source_evidenceePCR1381WS150 Sequence/Annotation Release
Overlaps_Gene C06G4.2 (3)
Overlaps_transcript (6)
WB_DNA_textTH:302E92019gtgattatgggacttggtggaaaagataattctcttggaaatatcggaaaagttattctggacaatattatttctggaaagttccgtagggatgttgatccattcgttcgtccaggaccagatccagatagaggaggtggtggaagtggtccaagccctatttcaccaagaccaactaccgaaccacaagacttctatgagctcagagatcaatgtcttgaggtgagtgttcaaaacatatcatttttaaaataataaattcagagcaaacgactattcgaggatccacaattcttggccaatgatagttcgttattcttctcgaaacgtccaccaaaacgtgtagaatggcttcgtcctggagaaatcacaagagagccacaactgattacagagggtcactcgagatttgatgttattcaggttagctcttggattattttcagaatttttaatatttgaaatgtactattaaaattatatattctttcagggagaactcggagattgttggctcttggctgctgcagccaatttaactctcaaggatgagctcttctatcgtgtggttccaccagatcaatctttcactgaaaactacgctggaatcttccatttccaattctggcagtacggaaaatgggtggatgttgttattgacgacagattaccaacgagtaacggcgagcttctctatatgcattctgctagtaataatgagttctggagtgcacttttagagaaggcatatgcaaagtaagttcggacttttgaccgacatttatgaaggaataaactagttaattaattttcaagattgttcggatcatacgaggctctcaagggaggtaccacatctgaagcacttgaggacatgactggaggactcaccgagtttatcgacctcaaaaacccaccaagaaacttgatgcaaatgatgatgagagggtagggattaaagtctaatttacattattatccaaaaacgagttgtgccaaactacagtacccggtctcgacgcgacaatttttgttaattatgaatgtctgtgcgcctttaatgagtactgtagtttcaaactttcgttgatgccgaattttcattgattttgcatagttttttgttagaaacagaaataaaacaattaagaacacacaaactatgaaaaatcgataaaaaattccacaaaaataaaatcttgaaagtaaagtactctttaaaagtgatcccctatttatattcgacaaaaagttgtcgtgtcgagaccgattaccgtattttttgcgcaaattttagcgtccatgtattaacaaaatttcagattcgagatgggatccctattcggttgctccatcgaagccgatccaaatgtttgggaagcaaaaatgtcgaatggtttagtgaaaggacacgcctattcaattaccggatgccgaattgttgacggaccaaatggacaaacttgcattcttcgaatccgtaatccatggggaaatgaacaggaatggaatggaccatggtcagacaattcacgcgaatggcgaagtgttccagattctgtaaaacaagatatgggactgaaattcgatcatgatggagagttttggatgtcatttgatgattttatgaggaatttcgagaaaatggaaatttgcaatcttggaccagatgttatggatgaagtctatcaaatgactggtgtcaaggccgctggaatggtttgggctgcaaatactcatgatggtgcatgggttagaaatcaaacagctggaggatgcaggaattacatcagtaagtaaatattcatctacaaatattttcaattttcaattcagacactttcgccaacaatccacaattccgagttcaacttaccgattcggatcctgatgatgatgatgaactctgcactgtaatattcgccgttttgcaaaaatacaggtagcgccaccagatagggaaatcatttttatttttccaatttttaagacgtaatctgaaacaagatggacttgaca