Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302F11   

TH:302F11RNAiTH:302F11
PCR_productTH:302F11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF09G8.4 Source_evidenceePCR1307WS150 Sequence/Annotation Release
Overlaps_Gene F09G8.4 Source_evidenceePCR1307WS150 Sequence/Annotation Release
Chunk_score Abs_score1120
Max_abs_score1120F09G8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII82604658262342
F09G8.6 Source_evidenceePCR51WS150 Sequence/Annotation Release
Overlaps_transcript F09G8.6 Source_evidenceePCR51WS150 Sequence/Annotation Release
F09G8.4 Source_evidenceePCR1307WS150 Sequence/Annotation Release
WB_DNA_textTH:302F111878aagtatcaagggtgctgaaatggcacgttgcaaatgataaattgtgattaataattttctattttcagtactacaccgctcggactattatgataacggttttaatcagaggcccagaagatcaagctatagcctgggaaactgcgtttctaaacatgatgagtcgttatgaaatgaaacacgcaaattttacattcatgacagaaacgtctgttgcggttggtagaaaattcatgtaatttcttaattgagtgtattttccaggaagaaattcatactgctgtggagactgataaaattgtgtctgtgattgcatgtgctgctgttcttatatgggttattacaatgcttggaattaatcattggccagagtcatccatattgtcagctctagttcatcacaagctactcatttcgatatcagctgttatgatcagtgtgatcagtgtttggtggtatgtcagatcaaaaatatgttcaaagcttttgagatgttgagacacctttctgccaaattttggaaaattactgttgaactgtgttttcttacgactttctgtcaaggttttgtaactttcttacaacaagttgaaaaccgaggtgcaagatatgcatagtattacagttttctataaaattttagttgacaattttctgacatcaccctaatcttgatttcagctcgattggtatgttctcgctctttggtgtccatgcaacagataatgcaattgttgttttattctttgtcatcacttgtcttggaatcaatcgaatctttgtcattatcagaacatttcaagccaatggtcactgctacggacttccgaatatctcatatcgagaaatgaatcacagaatttcaaatgtaatgcgtcgaagtattccaattgttctaacaaactcccttatctgttcaacatgccttttcttagccggaggtgttcttccatatgtatctgtcagcatgccagcagttgaagtatttgcaagacatgctgggttggcaattcttatggatactgcattctatctccttgtaatgctaccactatttcaatatgatgcgagaagagaaatggtgagtacgttcattaatactgctgataatgcaatctttgtgaggtgaacactttgaaaataaacatttcagtctggaaaatgtgaaatctggccgtggtacgagctatcaaacgagtcaaaaattaatctatgcatggaagcagttgatggaaatcttcgaagcccagtggattggttcaagcttgcgatcgcccctttattgctcaaaaagatttgtagaatttggatagctacattcttctttgtttccctaattatagcatgctactgtactctgtgcctcgaatttggtttcaatcaagttatggctttttcagaggtttgtatttttattttttcccacttgaatggaagttttcagacaagttatctgacaaaacatttccaaaatatgaatgagaatttgaacattgggcctccgttatggtttgttgtagaaggtgatgtcaaatggcatgatccgaaaatgcaggttcgttgctttttttccgaatttctttgaaaataaagttcttataattttgcagaacaagttttgtacattagccggatgtgatgataattcaatgggaaataagatccgatcattggcatacgctgagaactacaaaggaaactatctacacggcgatgtaaatatttggctggattcatatcttcagttcatgcatcctcgaggttcatgctgcaaaatggatggaaaacaattttgtaggttatttgcaaggacaactagcgttcattctgataactttgataagggataagttatgaggtaaagaaaagagagttggg