Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302F2   

TH:302F2RNAiTH:302F2
PCR_productTH:302F2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF23F12.4 Source_evidenceePCR802WS150 Sequence/Annotation Release
Overlaps_Gene F23F12.4 Source_evidenceePCR802WS150 Sequence/Annotation Release
Chunk_score Abs_score781
Max_abs_score781F23F12.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64988696499718
Overlaps_transcriptF23F12.4 Source_evidenceePCR802WS150 Sequence/Annotation Release
WB_DNA_textTH:302F2850cctttctaatcatttcgatacattttctaaaattattttcattttaagatttacctactccatggtagccgaagaaacaaaggctctcgtgaaacggctcttcaaaaaagtttcatttcaagtgagcatctttgttcaagagcaagactattcagtgtcttttggacaaatcggaggagctatatccaatcttggatgtgaagttttgagccaagaaagtgagcaagttaatggaacacaaatatggaaaatggacgagaatactgaagtacaaatggaacattactacgatggtcagatttgtagaagctattggaagatgaagaaggaaactgaagcgatcttaaaagttctagactatctccgatcagtgttcaatgtgaaagaagtttcagtcagcttttctattgatgagaaatatgatgctgtggagttcttgaagtcggttaaaaatcgaggagttcaactcaaaaatgtgaatattactggctttgaagtaacgttggaagcggaggcttataaaaatctccttaatgaatgtacagaaacatctgaactcaacgttgcccctcacgtaaactggggatttgagtatcctgtttcaaacttttccaacttttgccaaaagtttttgacaattgagcatgctcattgggtgactgttcatcatttgaaatctttgagaaactgtgcgtctgtaactcttaacaattcaaagttgacaaatcagaacttgaattggtttcttcgagaatggatggaaatgagcggagcttcgttgcgaaacgtggatttggaagttaaacaactcgatttaccacggattattaatggattgaaatggacaata