Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:302F3   

TH:302F3RNAiTH:302F3
PCR_productTH:302F3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F28F5.3a Source_evidenceePCR636WS150 Sequence/Annotation Release
F28F5.3b Source_evidenceePCR636WS150 Sequence/Annotation Release
F28F5.3c Source_evidenceePCR636WS150 Sequence/Annotation Release
Overlaps_Gene F28F5.3 Source_evidenceePCR636WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII68093286810254
Overlaps_transcript F28F5.3b Source_evidenceePCR636WS150 Sequence/Annotation Release
F28F5.3a Source_evidenceePCR636WS150 Sequence/Annotation Release
F28F5.3c Source_evidenceePCR636WS150 Sequence/Annotation Release
WB_DNA_textTH:302F3927actgacttcgaaaaattggcaaactttaattagctctatgtatctattcgggtttgagctgcaccaaaaaatattttttcaaacatattaaacgtgctcaaagccagatccgatttcagtgtccttcttcaaaataaaattcaaaaaaaaacaacaaaaccacttttcagtcaaaagaagaaatcctccaagtgaattcggcgtctcgaccagcactgccacgtcagcattcagcttctacagtatctccgttgcaaagttctagtgacgagctgaacaacgattctggaattgacaacagaacagtgggatcaccatccacttcagaattctcaccgagaagtaggctttgagtttggtttacggaagtcaccagtttttaaaattttgaaataacgatttcatatcattaatttcaggcacagacctcttcgtttcacctaaaagtataattgacgaagagcctccacatcatcctccaccaccaccgccagttgaggagaaactcgatcaggtgctcattcctctgaaattatctcgtggtcaagactacgctccaatttatcgaagccttgaacaagacacttattatgatcaaagcccatctgaaagtgagaaggacgaggatttaggtttaactaacacaaaacgttacacggtgagatttttctttaaagacatttataaattttaataatttaggaaaactttcgatcagtcgaaaaaaatcaatacatgcctgtaatgtcggctcgtgtggaagcgacattcaagcagccaccaccacgggaaggtgtcaaaccatttgtttcacgagctgctcaagatatcactcacaatggggaatcgaaagttgaaaatatcgatttgacgatagaattgaacagagagcagaaagcaactgtgacagcgacaaagtatccaaga