Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:303A7   

TH:303A7RNAiTH:303A7
PCR_productTH:303A7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C26E6.8 Source_evidenceePCR1409WS150 Sequence/Annotation Release
Chunk_score Abs_score1283
Max_abs_score1283C26E6.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII49183624920015
Overlaps_transcript C26E6.8.1 Source_evidenceePCR1409WS150 Sequence/Annotation Release
C26E6.8.2 Source_evidenceePCR1409WS150 Sequence/Annotation Release
WB_DNA_textTH:303A71654aaaatttgaatgttgccgactcctgagtatgtccatcaaaaatgaatgtgttatcaatgggaacatattgattggtagccaatttgataatctcttgagcagctattccaccgacgtacgatgaaatgacatgtaactccgcagcaccaaaacgacaaatttcagcgatagcagtgtctgtcactttatttgagattgatgtgaagtcctgttcatcctaaaatttgttaatagttttaatttcactaacgaatgtaataaaccttcaaagcttctcgaatcaaaacttcaactctcttcttcaaatcttgagcatcaattgaaactggaactccattagttcctgggtaacgtcctttttctttttggaaccttccaactgccctcatcagtagcatccacgtggcttcatcaactttctgatttctagtctcttcatcaatattgctttcacgaattttctcaacaattgctttggtttcttcgttgtagtcaagcacatcgccatactgaactcgaatccgatcagcgttcttacagaaacgatagcaaacgtcatccgatatgacgtcaccaacacctcgttccttctctacttcacgtgtcaaacgaagcacttcctgagcatctgaaagagctttttcgtggaaaagagttgcgaggcgagtgtatcgagaagaatcagaagtcatatcaggaagagttccacgaagaggcagaagattattattctcggtgacaaaacgacgaagagcttcacagattaaccagaatgggcgtgtcgatgttgaacattgtggagaagagagaatcgattttacagaagaaccaatctgaaacttactagaaatgagaatcaatttggataatttatcaaaaacttaccgtagttctttgaaaagctcgaataaccgccgctttcgcctcatcaaaattctcagaatccttggttccggattcttcactcgaacgtcggaaactcataagaatcgcctgaagttctttacgttccgcagttgtagatgggaacgcttcaggatcatttcgttgctttctgaatacttcgagagctgaaattaagaaggtaaataacagaatacaaccataattgcgagaaaaacctttgaagtgaagaagaatatacggagtatggcggagttgttctagagtcatttcatctagatttgtttcattgatcatttcaataagctttgaaaatggagcatccaatctgagaaataaaaacttttttggaagttttcatgtatattttaccgtaaatcaggtctcggattctcttcgtgtgagttagcaattgtgtgttctttgatgcagattcgaatggtaccaattagtccaaaagttctgaattttggaattttaactgcaagaacttcaaattttgaaaatatcgtacttgatacagatgaatggaactctaatattatacaaaactttcgcgaacgtcgtatcaatttcttcattttgatttgcagcaacaaccacagaaaacgttgtcagcttttccacatcttccatagctaacgctgttggtggctgactacttgcactaccagagactgatggattcagttcggtaagcttctccaatgttgcctcggcacgagaacgtccaatatcatctgcatggagg