Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:303C6   

TH:303C6RNAiTH:303C6
PCR_productTH:303C6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC35D10.14 Source_evidenceePCR1260WS150 Sequence/Annotation Release
Overlaps_Gene C35D10.14 Source_evidenceePCR1269WS150 Sequence/Annotation Release
Chunk_score Abs_score1164
Max_abs_score1164C35D10.14
Specificity_index0.931
Rel_score1
Map_statusUnique_ePCRIII48818114883809
C35D10.15 Chunk_score Abs_score86
Specificity_index0.069
Rel_score0.074
Overlaps_transcriptC35D10.14 Source_evidenceePCR1269WS150 Sequence/Annotation Release
WB_DNA_textTH:303C61999atcagatgctgatgcgttgatgcgttgagagatgagagattgagaggtttatgagaagctttgaaaaaatcaagtttttattattgaataaatccagaacaatcatagtgtgaaagatgtgaatctagcactgaaaccttgagcaacaccacttccatctgttttaaatgtcacaaacatgttgtttccagttgaaactacactgaacgggtccaaacttccactataccttcctatttgtgaactactagctgattctccattgtagaccacaacgagatcaaagtttacctctgtggcaaacgctgaaaaatggagaagcactcgataagatccgagtgttgatagatgataagagcagaattgattattgtcgtagttgctcggataatttggagatgtaatgacaccaggtgcaatcagaagtgtagaattgcaaaatgatggattggaaggaaccggggttactgttactggtggtggagtgccagaacatttgatgccagctgatcttttacagataaaaggcacagcggcagtacatgggaagctaaaccaataacccatcggaactacacttggttgataattcgataaaagagcacagtttcctccatgaccaaacgattgatcaatgttagtgtaatcagagttagagccatccaaccaattgaatacagacgatgacggccacgacgcaccgatatatacactggaattcgataagttcataattgaactcataattgaacttaaatatcggttttcgttagaagaatgaattgaggcaagatttccacattcttgttcacaaattgcctgagcttgcacaaaagtattccgttccgtatgaagcgtgaaacaatgtccattgtaattgtatgtacaattgtctgaatacttttatagtatacaaataacaattttctacttacctgcatgagtagctggcagttcacagacaaatgctctcgggtccgattcacagtttccattcagccatttacctgccaacgatccttgtgtagagtagtaaacacactttccgatatcaacaagtggaaaacctaaaataatttcaaaatttcagaaagtttcttatcgtacaccgtgcaccaacagtatacatcttttgcgttttcttcaaccactcgacggcgatatggaaacatttgatctaacagaaaaatcaaactcaccacttgcaaaactgttgtacatttcagcagaaccagtagaatcatcccacaaacatttggtcacgtcattgtcaaaacagtaaagtcctatccataggagggaaactgaactggcagcaattgttgatatagctcgattatcctggaatgtaacttgaacgtaagttgattcaatttacagaacattgttttacgcgcaaattagttactttccctctggtcaacagttgctaggagaacaatacagacgaataccccgagcagacacacaaatacattggaaaactatttttaagatgctcgggagtgaattgcatacttacaattgcattctttacagtcaccagggttgctccgtactccgtacatttgctctcagcagcagtgtgaccaagcggcgtggaaaacaatcgtagacatttattgttaattaatgtgaatccatttgtgcaaaccagcggttgtgctccaaaggcagagaaaacaaaaagtgagagaagaactagaagctctctcatcatgaaaagaatgaataatcttcttatctattccttttaaatagaaacggatgggtggaaaaagagagaataatggaaagatataacgaaactgataaaaattatgtgatcggaagtataaaagtaaacagagaattaaatgattgatgaaattgcctcatttttaattttgaaattgttccagcaattattacataatcagatacatcaaacattggttaagaaatttagttcagattttcgtcttgctattattggaaattatgtgtcaactgaaaggat