Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:303E4   

TH:303E4RNAiTH:303E4
PCR_productTH:303E4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF35G12.1a Source_evidenceePCR1137WS150 Sequence/Annotation Release
Overlaps_Gene F35G12.1 Source_evidenceePCR1230WS150 Sequence/Annotation Release
Chunk_score Abs_score957
Max_abs_score957F35G12.1
Specificity_index1
Rel_score1
Map_statusBest_ePCRIII45662824567841
F35G12.2 Source_evidenceePCR166WS150 Sequence/Annotation Release
Map_statusBottom50_percentile_ePCRIII45662824567841
Overlaps_transcript F35G12.1a Source_evidenceePCR1230WS150 Sequence/Annotation Release
F35G12.2.1 Source_evidenceePCR166WS150 Sequence/Annotation Release
WB_DNA_textTH:303E41560caatcacacgaatttgttacaagtataatatgacacattaactagactaaattcttgaaactcgaatacatatgaggagctgggtgaaaagattcagaagatatccaaaactttctgattaatcgccatctttttgtgttcagtgtaagctgcactgttctcgtgaaccttctccaaatcgtatctgaaaattaaatttttagactcaaaaaaggttcgaccgagtcatacctgtagtttaccataattccaaaactgttattgatccctctatgactcgtatctccattccaattcagtctatacaactctgcgccgtttctaatgtggaagtttgcttaaaataatttttttttcaatgcttatcgataaaatcatgcttaccaactgaatttaaagccattccatttcgttttgcattacaaagataatgagcacacgcgtacatcaaaatgtgctggattgcattgagctgctcctttttcgttttttcattgcttatgactttcagtagagtttcggttgcttctacttcgttcatttccctttcagatatatcagaaatccaattgacaaccttttcattcataattgaagctgaaaaaacattgaaagtaactcaattgtctaaaaatgtacagcttacgatattctgaattccctttcagatttctgataagccaaggtcggaaaccaggaatcggagataatgttgaatgagttgtgactgatggaacatctttttgaagtttagtggcgactttcttgatgagcatatttccgagatcaataccagaaagacctgaaaacgaataaaacatgtaatgaatacatttcttaaattttaccaggctgtgtagaagtgattgaataataaattgcagttgtttgatcttcttcttttccagtcggtgctcctctttttgtgatttcttgtacactatccgctatctcatcaactaatgccacgtgaaccatcacaagtgggttccggggaagagcttcgtgggaaaaatagaaacatctgagaaaatgaaattttagttttttatttttatttcataattaccgtctcaacggaccaagacgttttctgaaatctgaaagtcctctaactggatgaactgcctcatattcggcgactttctgtagaatatctccaggagatgaccacgtaagtcgttccaattttagatttcctaaagaaaaccatgaagttaatacttctctagtggccagttcaatgtgacggagatatgatgttgtagttttgtcagtttcccgttttagaagtgcctgaaaataattatatattcgatgctaattttattttaattttaataccaaaatattagccctcatttcacagacttgcataactcctcccggtaaatttccaattgattttatcaaattcacataagaagctgttgctgatgttcttacttccgggtacatttgatcattctgaactttacaatttttggtcatacgatgtcaatgataataaccaaccttagaatatagagaaatcgcatgatttagggcttctttgtttac