Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:303G5   

TH:303G5RNAiTH:303G5
PCR_productTH:303G5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26A1.12 Source_evidenceePCR696WS150 Sequence/Annotation Release
Overlaps_Gene F26A1.12 Source_evidenceePCR745WS150 Sequence/Annotation Release
Chunk_score Abs_score661
Max_abs_score661F26A1.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII48433184844408
Overlaps_transcriptF26A1.12 Source_evidenceePCR745WS150 Sequence/Annotation Release
WB_DNA_textTH:303G51091aaataaatcacgaaaagtgtcaatggttactgtagttgtacgttggtgtactatttggtattgtgaaatcgaaaaaatctgggtttaaaatattcattatcagataaacaatggcattcagattactctgaaatcattatgccggttttccacagacatatcctctgtatctatcattgggattatttgccagacaaatatttgtgaagaactgtccgtggatacggcctccttcgaatattcccccccataaccacattgtagcacaattcaactgaactccactggaaaaatatttgttgatgaaaattggcaaaatattcaattcacccccaatttccatttctcggttccgctgggctccaaaggacgccttctaggttgttggcatcggtgctcccgtctgtgttgtaccatggctaggaattaatatattgttttgattaaaagtacccgattcttaccgctccttgtgaattctttctcagtcccacacgaatagttccatacttccaaccagttggcaacattttttccaatcctagccgagcaattgtttctcgttcttgagcattttccacggatgaaagaactgctccctgagctctacaagcattgtttgatccttctaaacctgcagctccattgaaaacttgaatgcaccatggtccacgacgcctgtgaataagagaccaaccacctggacaacttggtgcaggtgttgttggtggaggtgttgctggtggcggtcttggtggtcgatttggtcttggaggtctcggaccatgcttatgatgatgtcctctaccttcaccactgctatcagaatagcttccgtcgctactatcgccgtggtcaaagaaaatgcagttaactgaaatattcagtagttttttaaagcccgttccgcatgttctatctagaatcaacccgtctttgtgaatttacgcgaaataccaatttagctagacctagatgaaaaattgaaaaacatatcacacttaccaactgaaagaacaacaccaatagatatgaaaactttcatgctccgcattttcaaaaatggaagaatactgttctcttccattcga