Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304C1   

TH:304C1RNAiTH:304C1
PCR_productTH:304C1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F01F1.8 Source_evidenceePCR1774WS150 Sequence/Annotation Release
Chunk_score Abs_score1644
Max_abs_score1644F01F1.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII58536225855894
Overlaps_transcript (5)
WB_DNA_textTH:304C12273gatctttgttgattatcgctcgaagaaagctataaaaacaaacggtaaagttgggcttgttgaacgggatggggaatattatcaaacacggcaacagatcatagaaacggacacactggggggaatagaaaaacaattttaatatttattctggttgtggctgcttcaagttggtcataccagcgcgcatcacttcatcaacaagcaagagattgcatgcaagtactgtcgccgacgagatactgttcttcttcaccgtcacattgtcccaaattccttgtggctcgacagctcctccggtttcgagatcgagtccaacggcgatatctggtccagcggcggttttctcctcaataagcttaacaagtgtttcctgagcatcatatcctccatttacggccagtgtctttggaataacgagaagagcttgagcaaacgcttcagctccgagcttggcacgtcccttcaggttctcaacatcttttttcaacatcacgtaggcagcaatttcgaaagcagcagctccagggagaacagcctctgaaaataggttactagaacagaagttaataaaatttaaactcactgtcaacgatggtgttgaaaacagcacgaagtccatcatgaatagcatccttgatttgagtgatggtatgcttgtttggtcccttgataagaagagtcacagattttggagcacggcattcctcgataaacgtgtatttctcttctccaagggaatgctcgtaaacgagtccagcccatccaagatcctctggagtcaaatcatcaactgagttgacggcttctcctccgacggccagctgaagacgttccatgttacgtctcttggcacgacgaagagcaagaattccttcggaagcaagcaagtcaagagatggaggatcgattcctttctggttgataacaacgaatcccttattcttaccatctggagaattatcaataaccttcttcttcaactcaataatcttgtgaacacgacgagtaatgaattcacgttcggcagcgagaagtgcctcacgttccttggcggtcttgtagaaaagtcccgagttgacttcagtcttctcgtattccaaagaaacgttgcaagtgagaatgtaagcgtctttaacgtgtcttggcatatctgggtgacgagctccatgatcgagaactaatccacgaacaagtgtggtatccatatcactgtcgtggtgcatttccatcttttcaaccatatgaagatctggttcctctccatcacgacggattgccaaaacggcgtcgacaacgcatctgaaattaagaagataatgttttttactactttttaattgtttgtttcttactcggtgatgtgatcagcaagtttctgatgaagtttggtacgaagagcagtgcggcacacctctacaaggaggtcacgctcaacgggagcctctttcttgaacttttcaagcaactcgagggtttttgtgttagcccactcgaagccttcagtaacaatacgtggatgaagaccctaaaattttaaataaatgtttaaagttaaactttggaaattgatcacctcgagaactagagattcggcttgtttcaagagctctccgataaggagaacggtggatgtggttccatctccagtcacgtcgtcttgtgccgtcgaagccttggcaatcattgaggctgttggatgttgaatcgcctgaaattaaatagtgctaaacgctgaatctgaacaaaacgatcaaaccatttcgtgaagcaagacatttccatccttcgtcaatttgatatccccagctccagatacgagcctgaaaatgtgattatagtctcaattatacatttgatcagtttattctcacatcttgagagttccctttggtccgaggttcgatctcatgacgtcttgaagtccacgagctccactaatattaagctcgagagcggcagcatgcctagctaactcagctttcgggttcaggcactggattgacgacatactacctgaaaacaagaattcaactatgaaatatctcagtaaaaccaacaaaaactaaaaaacggagaaatgagattggaaaacgattcaagaggaaaatagacacgcataaaaaggttcgagagcatattacaattcaaaaaggttctaaaatgtattattacataactttttaaataaaaaataaagactttcaacagaaatccttgaaaaacaatgattctcgtttgaatttattctagaaaataaattcgcttctaaa