Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304D6   

TH:304D6RNAiTH:304D6
PCR_productTH:304D6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST12A2.11 Source_evidenceePCR943WS150 Sequence/Annotation Release
Overlaps_Gene T12A2.11 Source_evidenceePCR943WS150 Sequence/Annotation Release
Chunk_score Abs_score859
Max_abs_score859T12A2.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII62624596264096
Overlaps_transcriptT12A2.11 Source_evidenceePCR943WS150 Sequence/Annotation Release
WB_DNA_textTH:304D61638tgatgacagaagtgactgatacaactgtcgaatgctttggagccatgcttttgactggaatcacatgatatctcaattgtccactgataagaaccatcacaattggtgagccaacgttgagaacatcaaatgcaaagccttgaagaaaatacacaagatctgtgtatgcagcagttatgctgaagaacgcaaagtagctctggaagtttagaaaattataattgtacctttgggcagatatttacttgaaaaagagcggcactgaaaaaagcggccgacatataaaacgatgcaaaacacaaagttcgctcagaacttttcaatcgattttccaatctcctcattttgaataatgtgatagaagttgtgaaaacagtaattgtaagagaaattgccatgaaaatcatttggaacattgatagactcgcccagcgaacacgttttgtgtaggccagagtgaaaccgccaaatattgaaacaggaaacgtttcggatatgataacattccaaattactagaaatggtgacaatgtgataaaagcgattgtgacagggatgaaacgacgccagatctcaaatttaattatattatagaatttagaaacgcatttttatgcatttgaaattttcgttaattgtagattgtagattaattgtagatacagaccttgtaatttgttcaatttgtgacgaatatcgaacattggttttgtgtttttcgacttgaaaaacgtaataaatcttacctgagaatatctcaatggtgccagcacacatgtcatccgattgacagtcaaaaatatttgaataatagattttgcggctctcatgtaattgtaaattgaaaaaataatatttggaaagagaacataatgctcaaataatggatataacgacggacacaattgaggtatgtaaataataacccgttgtatgaatagatcaagaataagctgagttagactctagaaaaacttttttttttggaaattatttttgttttttgaataagaaagttttatgtcacatttttaagaaattacaagatgaacagaaacattcaaacttttagttattaaaaattcactactgttataagcgttctcgttaataaaaaagaaacctacagcaatagagtccatcgaaaaaataatgaaaaacgattgaatcatatagatttttcgatgttggaagagcataatactgagtattcgaaaatgaattataattccaggaaccatatagaatagttgagttaaatatttcaaattctcaggcaaaggatcataggttaagtcacatccatcttcaaatatatcggaaaaactggaattttgtgacatttcgaacaatggccaatttattacatagccatttctatatttttttcgattgttttcaaatttatccaaatatgtttcggtcgctaggaagtaggtaggaaaattaaataaatatcacataaatataaatctcttacttggaagccgttagaactgaatgaaccattattttattttccttccaggtgattttttatttccctgattgcctgtcgtttttttagtatttcagacaacttttagacgaatgacgaagaaggttctatagaaaaagcagctgaaagttttgtagtgg