Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304E3   

TH:304E3RNAiTH:304E3
PCR_productTH:304E3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZK328.7a Source_evidenceePCR602WS150 Sequence/Annotation Release
ZK328.7b Source_evidenceePCR602WS150 Sequence/Annotation Release
Overlaps_Gene ZK328.7 Source_evidenceePCR639WS150 Sequence/Annotation Release
Chunk_score Abs_score555
Max_abs_score555ZK328.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII60383816039751
Overlaps_transcript ZK328.7a Source_evidenceePCR602WS150 Sequence/Annotation Release
ZK328.7b Source_evidenceePCR639WS150 Sequence/Annotation Release
WB_DNA_textTH:304E31371agtctctccttacccatcgggatactcctgtcccccagctttctcaaatagttcttgtgttgatttctgtttcttccccaatgccaattcaatccatcccaatagacaataatgtttagcatgcttctccgttgctctttttcttgcaatatccaacatttgcttggatttttggtactccccggcaaagtagagtacctgaaatggacagaatgcaatcaataaaataaatgagcaaagacctcagaggcagtagcatacgaagtgtaaggagtcttctcatttctagcccgcgttgaaatttctgtctcgatttccacgatagatttgttatctgagaaaataattttatttagaatctccgtatttcaattgttcagaatttaaaaacctgggttaaaagcacttgcatgagcccatttcaacgcatgcagggctcccagagcaacatcgttatcagtcacaaaagtttccaaatgacgaattgcatctggaatctttcccagaagagtgagacagacacctttcagaattgcaagtgcaggatcttttatggtagccaaccgcccgtcgcacacaagaattgctgtgccaaaatagccttctctgaaaataattttaaattagttgaaattgtgtatgaacctttagtaattggcaagaaaaatagtttataaaaaaatgaaaatggtttacaatttctaacactttccatacatttataagttcaagaattgagttgaaaactaactaatagtataatatgtgagattcagccggttaaaacttcgaaaaaattaccgagtattattaggtgttctttcaaaagaacaaatatttaaagcaatatttttagaaatttttttttaaaatttaaacacttacctcgcataataatgtacattggacacagctctccagtgctccacatccttgtgtccccattttttgcgatcttctgggtcatttggattatcgtcagattcggaatccatttttaaattgagatatcagcaataaaaatattgctttgacaaaacagccatggagaatcggccgtgttgaggcggattgccatggtaaccgggagaagctgagcggagcgcgcgaggttcgaaaaatgacggaagggtggcaccgcgatcgagaaagtaattgtaggtaggctttaggtggtgtatacagcagtctaccaacaatttcctgaacttttttgtgaacttggggattttcatttgcctaaacatattgagctaattgtaatttaactaattgtgaatagttttaaaaaaaatttatttataattcttctaactagtaagtttgtgtattccgttttgttacagatatatcaaaaagtacacactctgg