Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304F1   

TH:304F1RNAiTH:304F1
PCR_productTH:304F1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF01F1.11 Source_evidenceePCR1146WS150 Sequence/Annotation Release
Overlaps_Gene F01F1.11 Source_evidenceePCR1218WS150 Sequence/Annotation Release
Chunk_score Abs_score1092
Max_abs_score1092F01F1.11
Specificity_index0.902
Rel_score1
Map_statusBest_ePCRIII58694115871670
F01F1.15 Source_evidenceePCR160WS150 Sequence/Annotation Release
Chunk_score Abs_score118
Specificity_index0.098
Rel_score0.108
Map_statusBottom50_percentile_ePCRIII58694115871670
Overlaps_transcript F01F1.11 Source_evidenceePCR1218WS150 Sequence/Annotation Release
F01F1.15.2 Source_evidenceePCR68WS150 Sequence/Annotation Release
F01F1.15.1 Source_evidenceePCR160WS150 Sequence/Annotation Release
WB_DNA_textTH:304F12260gaagaaaccgatgcagattgaatacccgacagtgatatgagacaaaccagtgtagaaacaaaatgcattctgaataaatggttaaaaagcgtcgataatgaccaagtgaagcggagagagagagagagcaaacaatgattgggagagtggcagaaagaaaagaaaaagaacggtgtttggataggtatccagtgtttgtgtaaatggtacttttcttcacgaataaaacatgaatattattcattaaagttgattggaaacaacgtattcaagagatcgaaaattgataagttaaacattttttcaattgggaaccggtcgacgtacacgtggaataatgtcgcagagccgttgtctggaaatttaattttaatactattcagatatgaactctgaaatctcgtctcaaagatatgttacccggcctcgtcacgtacaattttttcaaaagtagtactgtagtgaaaaactaaagaacgctccgcaacagcgagcagcaatgaaattttatttttggtatttttcgaaaaaaagggagcgaaaatagagaaaaattctgttatcctgtcggtaactgaaaatataattgattttcaaattttacgctttttccaaaaaaaaattacacttataactgaatgcaaattttaaggattttaaaatcgaaattattttttaaacttactcaaactgcgttcgcttcttcatattcgcttcggaaggcagatcgtgttctcttttcaaaaatccttcataatctttccatgtaacacaagaagttccttgttctcgaccacgcaacgggctcaacagaatgcccgtgttcaggcaaaacggcatctctcggagctcatttctgaaatttaattcaatgtattttcaaggattcaggcacttacaagcaatctgtaattgcatctcgaaagaatctcgtcaatggatccttcaatcgacaagcttcttcatatcgttgaacacgcattgattcatcttctccaagtgaaattgatagtggtgtcattggatcgagctgatcgtatgggatgtttgcatcgctaattcctgtcaaatcgagcagaaactctggaaaaaacaataaaaattgattattggcaagggtatcattgaaattttttatggattttttttctgagaaaatcaaaaaaaaagtttagcaattttacaacaaaaaaatgttttgtttaaatcaaattaggcttatactgttatcaatcaatattattaaggaaaaacatataattgccatctaaaaaggaaaaaaggtcaacatttaaaactattttttgaaaaaacgaaaattgtttccaaatattggaaaaagcccatggattctctttttttatttaaaacttacgagtaatagttgaaacaatggcggatggtaagttaagaatggctcttctttgactatttccagctcttcttaaagtatatctccagatcatgcatctcggacggcacgcaacacaaaaatatgcttttataaactgcttggttttgttgagaagttttgcgtttctgcggaacgtcagcaaactgaacacatattgaagatcggcattctaaaatttggcattttttcatagaagctgaaacaaaaaaaaactcacagagaatacacctgttgctcgaatattgtaagaagtttgttggcaatgcgagagattcattagacttaaatcgattttatcgaattttgactctgaatttgtgttggtcgtctgtcctacaattgttcctctcaggtctttaatgtttgactttagcgcatttagctgaaaaatcaaaaaatggaattttgaattccgggctatcagaattctgaccataatagacgttccaagcattgcaaaccttccatcagccgccgatggattcaccataccttctaccagcgattccatagaaatatctccgagaaatgtggcttcagatattccgcaacggatggttctctccaatgaagcttcattgagcgttttatccgatgtcgacaccatcacacgtgttccaagctcgattatatcgattttctctgaggcaatgttttgctcaattttttctgaaacaataattgaacttttaatattttattgataatttttttacccattcgatggatttttttcattctttgagtcgtcttaaaatctttaatatcttcttttgcatcattataagaatcatatttttctccgcccatatagtcctctacatcgactacgtcttccatttccat