Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304G6   

TH:304G6RNAiTH:304G6
PCR_productTH:304G6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C18F10.6 Source_evidenceePCR999WS150 Sequence/Annotation Release
T12A2.1 Source_evidenceePCR220WS150 Sequence/Annotation Release
Overlaps_Gene C18F10.6 Source_evidenceePCR999WS150 Sequence/Annotation Release
Chunk_score Abs_score894
Max_abs_score894C18F10.6
Specificity_index0.818
Rel_score1
Map_statusBest_ePCRIII62687936270860
T12A2.1 Source_evidenceePCR220WS150 Sequence/Annotation Release
Chunk_score Abs_score199
Specificity_index0.182
Rel_score0.223
Map_statusBottom50_percentile_ePCRIII62687936270860
Overlaps_transcript T12A2.1 Source_evidenceePCR220WS150 Sequence/Annotation Release
C18F10.6 Source_evidenceePCR999WS150 Sequence/Annotation Release
WB_DNA_textTH:304G62068tcacgtagacctacacccaccagccagcaattgatgcatgctaaaattgtactcttacagagattttgaattctaagaatttcagataattttatatgaaaagtgcaagaaatcagaaaatgaagctttcttttatattagttactctcattaaaagcagtggcaccagcatcttgatttgagaaaatctcttacgccaaaggacaattaatttcagatcagaaccactatttgttgacattccacaaaaagtaagaataccttgtcatagtatgatgagtgttatgatgaatatgagaatgagtattattgatggaagatacacgttgagttcttccgattcttgaaccgagcacgtgacctcggaattgatcactcaccaaaaggaggacgagaggggaactgcaatattgctctttcagttttatttttatttttttttaaataagacaacacaatatccgatctacataatgaattttaacaccactcacccgacaaacaaaatatccatagttgcaaatcgtagatagttcataacatcgagcaaccaaggagcttctttgaaaaatgcaaagaaactctgcaattaaacattttaattgttaagtaccgtcagtactagaggttttaatttaacaatccattttttattctttcaatgttatgtgtgtctaaacgcagattagcagaaagttttacctgcgtaattgcttctagtaaaaatccgacagatattaatgcagctgctatacacagtgctctttcggaagctttaattctctttttcatcgttgtcattttataaaatgttactgtagttgtcaccattgtaatcaatacagttagaattattaaggtgaattgcataagtgatagtgaagcctgtaaattaatgaagcaatataaaaattggatcagaacctacccatgtcacccttcttgtatagcttattccaaaacctccgttaacataaccaataaaattatcactgataagaacgttccaaataactagaaatggtgccaagaaaataacaataagcattattcgaagtttttgagaccaattctggaaatatagctggaacatgtgataaatatcgcatattctacctgactataagtcactggaaacattacacaactcattcgattaaccgcaatgaaaatatgaataactggttttatagcaatcaaatacgacaaaagacagtaatagatcctcataaaaacaggagagttcttcacaatttctgagaaactcacacaaagttgtgggaaatacaaaaaagatcgagtgaatatcaattcattgctcattgccaaaacactggtgaaacagtcaacgctgtacaaattgtaaaatgactgatttctatagaaatgtcgttgtgagacccaaattacgtagaggatacggtagttaatacaaattgcagtgaataggtaggcaaattgatagaaataatggatgttctcattaaaattcgtgtatccagagatgcaatgctcataactcatttgcatagttttgataaagataaatgatgctaaaatatgtactgtgaactgattatttaaaacgccacaaatatagatttccacacgaataactcattagatatggtggacctggtggaaacaatatgcatgatttggcattgaaatatgggcctaacagtgaaaacacgcaatagcttttttagaacattggttccacgtgatttgtctttatttttagggtataagtttaataagcgctgccggaggaaattgtcccacaagtttgaaatggtatttacaggcccgcgcaatgtcgcatctcgaagaaatttccgacaaaggaatccgcgggatggctcaagcaggatcggttgctgttcttctaccatcaacagcctttattctccgtttgacacctccaccagcacgaaagttaatcgaaaataatgtgattgtagcgttgggatctgatttcaatccgaatgcatattgtctcgctatgcccatgattatgcactttggtatgttcgataaatttttgttcgtgccaatcttatatttt