Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304G8   

TH:304G8RNAiTH:304G8
PCR_productTH:304G8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C05D11.12 Source_evidenceePCR1715WS150 Sequence/Annotation Release
Chunk_score Abs_score1652
Max_abs_score1652C05D11.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64444956446537
Overlaps_transcript C05D11.12.1 Source_evidenceePCR1715WS150 Sequence/Annotation Release
C05D11.12.2 Source_evidenceePCR1540WS150 Sequence/Annotation Release
WB_DNA_textTH:304G82043cttgtttgattatctgcgtctcttcttctatacaacactttgcaatcttttcagaaaaggatactgtagtgggatgaatgtatatatgtaccacaattatggcaatattgaagcttttccgttcaagtacacactaatcagaaatctattcatttggtttggataaaaatgtaatggcattacaaaagatggggaacacgaaaatgagagaaaattgagagaaaccgttgaagaacagaaatacataatctacgagtcgatagtggcgaataaataagtacaaaaattatacacaaacataaacgagaagctaaaggattcacattccctcgtattttgggccaccacctccttctggtgtaacccagttaatgttttgttgaggatccttgatgtcgcatgtcttgcagtgaatgcaattttgagcattgatttggagacgcttctttgattcatcagcttcggatgggacgaattcatagactcctggaaaaaaaagttatttatgtgtttttaaaagtcaaatttgtattaaaatctcaccagctggacagaatctagcctccgggccaccatatactgccaaattcacatcaagtggaacttgatcatttttcaatgtcaaatgagcaggttgatcttctgtatggttggttccagtaagagatacagatgtaagaagatcaaaagttagctttccatctggttttgggtaatcgatttcttttgcatccttcactggaatgagcttctcattatccttctttccgtgtccaagagtccatggttcaattcctcgaccgaaaacatagaatattccagaatagatcagtcctccaatgtatcccaatgaagtattgaatgatggacgaatatttctggttgctttgagctctttaacaacataagtatcacgaatattcttgtcatatgtagctggatcaatcgtttgcacatcctctcccttttgttgaatatcctcgaaaattgattcagcagccaccattccacttttcattgcattatgagttcccttcagtttagcgacattcaagaaaccagctgagcatccaacaagacatcctccggggaaatgaagcttcgggatactttggaatcctccttcattgagagctcgtgctccgtacccaattcgttttcctccttccaattgtttagaaatcgatggatgagttttgtatttttggaattctttgtatggattgagatttggattcgcgtaatcaagagcaacaacgaaaccaacggaaacaagtggttgtccttgatcctcgatatggtacaagaaggatcctccgtattgatcaacattctgaaaaatcattttttagagattaaattctagaatatatcttttaatctgaaacactcaaaaaaaaagctcacattttactagatttttcaatttttcttaattttttagatcttcagaaacttaccaatggccatcccatagtatgctcaacataaccaggtctatgctttgctggatcaatttcccaaagttctttgagtccaattccataagtcattgcatgtgttctcaaatcaaatttatcgagaacttgcttgctcaaatgtcctctacatccttcagcgaaaattgtgcatttcgcgtggaattccataccacgagcaaatccatctttcggtgctccatcctttccaattccaacgtcacttgtggcaattcccttcacacttccatcttcattgtagagcacttcagatgcagcgatttctggccaaacttcgactccagctgcttcagcctgctcgccgagccattgaacgacctttccaagacgaacaatatagtttccgtgatttgcaagtggaactccaggtagcactggaactggaattcgaccagattcagtgagaatagcgatagattcagaggtaacttgttggtaaactggagctcccagctctttccaatttggaataagttcatcaagagctcgagtttcaattacagctcctgagagagtgtgccctccaataacagatgccttttcg