Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:304a12   

TH:304a12RNAiTH:304a12
PCR_productTH:304a12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F11H8.4a Source_evidenceePCR2034WS150 Sequence/Annotation Release
F11H8.4b Source_evidenceePCR2034WS150 Sequence/Annotation Release
Overlaps_Gene F11H8.4 Source_evidenceePCR2034WS150 Sequence/Annotation Release
Chunk_score Abs_score1908
Max_abs_score1908F11H8.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII70243327026600
Overlaps_transcript F11H8.4b Source_evidenceePCR2034WS150 Sequence/Annotation Release
F11H8.4a Source_evidenceePCR2034WS150 Sequence/Annotation Release
WB_DNA_textTH:304a122269aaggtttgaaggaaatcagcatttcctgtagcacgctccaactcatcgagcacaccagccttatcggcagctgaaaaaattatattaaaaaacaatttcaaaaatatcaactcaccagtcgaaactcgaatcatcgcagccggagttcttggcactctattaatcgcctgtctctcttgtaacggcttcctttcttgttgagattgttgcagctgcttccgcttctgtgtctcaaattctgcttcttttcgttttgcttctgcttcggcatccaactctttccaagcattcgaatattgctcagagaaggtgcgaatatcggcgaaaaattcttccatcggatattttttgtcgttaaatgcataatacttgaccaacgactcccaatcgtttttcatctttccacacattgacgaaactgtggagaactctttgacagctttttcgtggaacggccgcatcttctcgtcgaataaatcacgttctccttgaattttgtacacttttaagcagttctccagttttttaatgttattctctgtcagttgaacagtttttcgaatttcatccgcattcactcgggacgattcaatgcaatgatggaagtcggtgagagcaaatcttaaattttttaaattttgagaaagcaagtaaaggaatctactcaccgtgctcgtcttggatcgattctcttcatttcttcaattaaatgatgtagaagagtatgccgattatcgacatcttttgtatcaaccagtcttgtcagcattctcatgtcgaacgcgtaagcactcgaatagttttttgtcgctccgcccataaagtttccagtcgccaaaacaagtttcaaaaatgttcggaatccttcagatgctcgtacttcttcgcacgcttccatcactgacgacatggctggtttcagttcattcaacacttcagagaatcgcattttgaatagaaccaagtcgagacgaagcggaagaccttgaatttggagcagacgagtgacaaattgttcaccctcgggcatttcctcaaattgagccttgttcaccgctctcagcttgtcaataagctccttctccactggcattgctgatcgaagttgctccaagaatccgacagttaaaaccttttcgttgacttccaaaatcgccagcttgagctctgaatgcgacattttgattgatccttgaagaatgcctgcaagaaaaagatcataaaaaaggatatacttcttcgagtttacccaatttttgaagtaatttatcgtcatgaatgacttgtgctgtcttcactttctttttgctattcaagacaccaccaagagtaccactatttgcagcaggtttcgtggcgaatttggttcgtaaacgatcgaacattcgatcgctggtcagctgttcttcgtttgttccaacccagaacgactctcttggaatatcccgagggttgatagtatgtgctccccatgggaactttctcatgggaccatcaacctttggaaccttcttgggtggaaggtaatcaggtatcacgggagccatcggtgcgaacatgcctggaggaggtggtggtggcggtccgcccttgaaccctcccggtggtggtggaggaggtggaggtggacatcctccaggaggcggcggaggtggtggaggacctccagatattggaggcaatcctcccggtggaggcggcggcgggggtcctccggtgattggaggaagaccaccaggaggaggaggtggaggcggccctcctgtgattggtgggagacctggaggtggtggtggacctccagttattggcggtagagctgaagatccaccagcagatgtggatggagccgacaagttcatcttcgttggcggaggaagaggtatttttggatcatttatctgaaaaataacatgtttcaatcaaaccgcttctaaaaaagtaaatatacatgttttctcagttcttcagcttctttctggaaatcacataatgttttccagtattctccttgcattgcaacagcttcctgtttggccgacgtggcttgtcgaacttttttggccatctcttcgtcttgcattttatctgtaattaaaattatttaatttttcaatatactctcgatcacaaaccaatgatctcggccacaggaacctcaaacacaaacttataatccgcttgtggatcgattggagttcgatgcagaagaatatctgatatggctgtctcgatgagtttcatatacgatcttttcgtcgacatatcc