Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:305C7   

TH:305C7RNAiTH:305C7
PCR_productTH:305C7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC08C3.2 Source_evidenceePCR809WS150 Sequence/Annotation Release
Overlaps_Gene C08C3.2 Source_evidenceePCR809WS150 Sequence/Annotation Release
Chunk_score Abs_score705
Max_abs_score705C08C3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII77749307776243
Overlaps_transcriptC08C3.2 Source_evidenceePCR809WS150 Sequence/Annotation Release
WB_DNA_textTH:305C71314attttcgagatacaaacggtctgaaaatcaaaatttattttagttttcaggaattttcaaaaaataaaattttacttttaaattctccagctgatattggttagccatttttaacagctctctcatcgatttcatcgacttttcgatcaaaaactcctcgcattttcgaattgccaaggtaacatcgagcatgtgggcaagtagaagaactccatcgatggtaccatctgaaaatttaattattttaatttaaaatcaattcaatatctaaccatcaatcgcaggttctccatatagaacctccaaaaggctctgaaaatcggtcggatcgatgttttggagtgtaacctctgattgatcggcttctttgaattttccaagaaaaagtgcattgaaatatgaagaatgagacgccaggaactgaaaaatattgaatattgaatggaaaattcgattgtaaaaaaaacctactagtttcaaaacataaaacttctcgtctccaactacaaggatcacatcggaaaatcttttttctgattcatcgaagcttctgagcacatctttcgagaatcctgtcatttttgtgatcttcacacatgcttcaatagtaaaactattatcgtatagaaaatcttctgtcaatgagtcccaactgacaaaatcattccatcccagtccaaatccatcgaaacatcccttttggaatttcattgcataacttcctgatgatgaagctatttttaagctgaattcggcgtcgactgtccaggcgacgttgtcatctttctcattgtcacagtgtaggtacgcttccagttgatctttcgtgcgaataaccaatataaacctgaaactaaagatattttatgtaatctatgacttggataagacttaccattccgcattgtaatgaatttcttcggggcttttaaaaaaatcgccatcttccaattgtgaaacatccttgaaagtgtgatgaaacacgaattccttgcttgcggcgaccattttgaagagtttgctgaaattaaacatttttaaaactcaaaaagtcgaaaaaatcaaataatttttaaattaaaagtcatttgtccgctagaaaaacgataactttgcaaagtttgacgaaaaaaaaaagattacaaaaaatctaatgtgcgtaaattagaatgcattatgttcattgcgtactctctcatctaccgtagttcgctgactatttgttcgaaatgcagcatttatactatttaccatcgatagatccttctaaaacgcataaagtatttaattatgtttctacttcggaaaataatg