Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:305F2   

TH:305F2RNAiTH:305F2
PCR_productTH:305F2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF37C12.12 Source_evidenceePCR1077WS150 Sequence/Annotation Release
Overlaps_Gene F37C12.12 (3)
Overlaps_transcriptF37C12.12 Source_evidenceePCR1077WS150 Sequence/Annotation Release
WB_DNA_textTH:305F22231ccaatattgagcgacatctacgccttcccaaccggcattttccagtctgtctagatacctgaaaataatgaaatatatgtgagaagctcgttacacgatctcaccttcgcattatccgatctcgaactctctgctctacatctgttattcgtgaaaagttggataattccaggttgtctaatacttgttgcacactatccattccaaccagacaacaaataacgttcgggaaattgagagcatagtctagagctagttttgatatgcttatattcttagactgaaagaaactattttggaatttacaaaagtatagaaactaactgaacagtaagtagtggctgctaagcaagcttctttaatttcatcacttgctggatgccaaggcggtggacccttttctgtgagcaaaccccaacatagtgctccagaattgattactgcaatatttcgagtctgaaaccaagcagtaaattgtccaagagcattattgttcaatgtccctttgcagtatgtcatcacaaaatctattttagtagccgaacaatcgacaagttgactgaaaaatataattttggcgcattccaaacatatctaaacgagtacacaagttttcccaatggatatcccgtcagaccaatgtgcctaatctttccagatgactttgccatttcaagagcctgtagagtttcatatagaacaattgattcattcggagcaaagtctgcatcatggatctgaaatttgaatcaaattttgatatcttcaacaataagaatctcacctgaacatagcaaatgtcaatatatgtcaattgaagtcgctttagggaatttgtcaaagattccaggattttatcagctcgaaagtcaaatgtccgagcgtagtccaattcgaatctcccaacttttgtacttatataatatgcttttcgtggaatttttgacagagcctgaagtagaacatgaaagtgattcagaagtttaatcacttacctttcccaatattgattcactccgactctgactgtaccagtatcctgtatcgatataattgatacctaaacaagaatacaactattgaatcatagataccgtaccagggggtgcggtaaaattacgaaactgtaaaaaaactacggtagaattgaagaaaagtatttaattacctggaaaatggtttttagttttgtagaaaattttaaaacaaaaaacctcaagttttggtttccgatttgccaaaaaatatcatttctagtctgtttttcagatccttttctaacttcccaacattaatactatttatttttgaatcattagaatatgtttctatattttcacgtacgtttctgaattataaagtttggttaccgtacggaaatgaaaatttgcaattactttattcttaataaatttaaaactataaaaataccttgaaataactactaaataacttatgaaataatttacgattaataaaagctacaaaccttgttttatggcagtttccactatttttattatcgaatcttctacatttccaaacattcctccgattgcagcagcacctacaaaatagttgtttcaatcaaattataaataggggatcttgtcgagatggtctcaatatgaaaagctttaaaacaattgaggtattcccgaattatcgaaatttggcaaattgccaaaattctaatttttttaaagaaaattgctagatgcccgaagttactgaatgttagaatgatctgagcaagacaaaaataattttaactgtcttgttaattagagtaaccaagtcaaatgagagttcttcatccacctctatgaatttccataaattcaaaaatattaccgaatccaatttttgacattcgaatgtcggttcctggtatctgtcggtaattcattcgtcgaactgctgactcgtcatgaaatcgaggtatatatgttacagggagggacgtctgaaagtttttatttttattttgggatattttaatttatttgcaaaattcatttcaaaaacatttcctaacatacatcaacttgttctctgtctattcgtgtagatccggtacgatgatgtccagttggagcaagtgaaatacttctgggaagctgtcgagatgttgatggctgtaaagatatggttgtaaatgtggttatatacaatttgtcttgtctttgcaaaaaatgaatcttgtaatgtttcacttctttgtgcagttt