Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:305F8_1   

TH:305F8_1RNAiTH:305F8_1
PCR_productTH:305F8_1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F54H12.3 Source_evidenceePCR561WS150 Sequence/Annotation Release
Y57G11C.19 Source_evidenceePCR834WS150 Sequence/Annotation Release
Overlaps_Gene F54H12.3 Source_evidenceePCR582WS150 Sequence/Annotation Release
Chunk_score Abs_score561
Specificity_index0.493
Rel_score0.972
Map_statusTop50_percentile_ePCRIII79603627961262
Y57G11C.19 Source_evidenceePCR834WS150 Sequence/Annotation Release
Chunk_score Abs_score577
Max_abs_score577Y57G11C.19
Specificity_index0.507
Rel_score1
Map_statusBest_ePCRIV1483911414840014
Overlaps_transcript F54H12.3 Source_evidenceePCR582WS150 Sequence/Annotation Release
Y57G11C.19 Source_evidenceePCR834WS150 Sequence/Annotation Release
WB_DNA_textTH:305F8_1901aaaaattgagcacaaatgaagattgaattcagaaaagtgggcggctcttgaaattggcatggacaaatcataaagttaatactcctgatgcatcaatccaagagtcaaattcggcaccatatccatcccaacgaacgaggtgctgcttctttccgcgtactgtacgagtggctaaaatcttttcaattcggtactgtgcgtctggtttgtatgtgcatttagtcagttctcgagtgtagaatattccggcaattttttctccattagtgtctactatattgtaggttactggtttccttgcaaacactttggaaattacataaacttctgtagtccatccttgttcgtagcccttgtcaaattgtcctcgttttgcagcgattctgacgtgatctcctactctgaatttgattttaacgctgtccacaggcatcggagttgaaaaatctccccgctcaacgtctactggttttttaccaattccacgattaacactattgttgataccattcacaacttgttgcaaaacgtccacataacgtcggttgtacttttgagtcatgtactttgccaatcgagttttcagagtcctgtttgccctctccacaattgcacactttatttcgcttttgggtgaaaatagattcacaaaattcttggccaacaactctttgacatgcgagttgtaaaattcctttccatcatcactgtaaattgtcattggtgtgacaccaatttctttaaaaacgtcttgtagagcttcagccacttcttgtccttttttagactttaacgtttttacaaaaagccgtcgagagtaaatatctatacagactagtagaaaggttactccatcgttgtccttcttgtaccgggacatatctgcgagatcaatttgaag