Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:305e7   

TH:305e7RNAiTH:305e7
PCR_productTH:305e7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC27D11.1 Source_evidenceePCR1880WS150 Sequence/Annotation Release
Overlaps_Gene C27D11.1 Source_evidenceePCR1918WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII78263337828620
Overlaps_transcriptC27D11.1 Source_evidenceePCR1918WS150 Sequence/Annotation Release
WB_DNA_textTH:305e72288ttctgctcatccaatctcttcatctcctcagcacgagctgcttcctcacgtttagcttgttcagttgcagccgcagcagtcttttcagccttaacacgctcccagttctctttgtagttctccaacatcttcttgcgacggtggatacgctcgatttcagttggtcggttcttttcataactagtgacctgtccttcaatctttttgagaatctctttgcgtcgtttttcggcatcgagtccttcaacgagaccacgaagacgtgtatacattgcttcaagatgattacgaacaccttccactcccaattgagtatcatctccagtgaatccttcgttgttatcgcattcatcgactcctccggccaatgtcgcatcggatgatccaaagcgaacacaatcagcacgatgatccaattgagctttcacaattctatgtttgcttgcttcaacgacgagacgctccaatgccaagtcagagtaaaatggaataatctttcgaattcgttcccagctgatagcttcgtagatgacagatacttgcttcaaagccttcacagcagcaactgcttgaagagactcaacatattgcagatggtcagggcgagtgacagtatcaagaacagattgaacatccttagctacttttaatggtgagaaattactctcaagaagcttgtacagatccttggcggtttgtccagcagcttctggtactccaatccgtgcggcttccttgagaattccgtttttagttggagcaattggaagacgaagcaaatttgagagaagtctcatgttggctacatgttgatcctcaatatcaaggttgcgagacaaatcagatggcgaatctgatccttctgggatggaaagagtagcgagaagcactctagtagcctgttcttgtgcttcatcctgtgtgaaagacttcttcatatctttgtaaatgatgaacttttgaagaagggcggcggcgtggaacaaactgtttcctgctttccagaacaccaatgcaagtttgtcataataattgacatagcttgcaggttttaccgttctcttgtctttgtcttttgaaagctgcatcattccgtgaacgtcttctgcgcttctgaaaaaataacatataaaatttgattaaacaatcaattcactggaaaaataatccctcgcacatgaactttaaaaaaaaacaagaaaaacatacttgtaagcttcttgccagagctccatctgaatcgcagtatccaattgaatcaatctggtgtcttgcataagacctagagattctggagaagtgagtttcacacggaaagagtttctgaaagaacagaaaatattttaattagcgtttactgaatagtgtcatcacttacacatttggagcatattggtgtttttgtatctgattcagatgcatacggaggagatcgcacagctttcggaactctgttctacgttgatatctgagacagaaagtgaaagagtggcgagatatggtgtggtagagttgttcaacttgggcgttgtttctcaacaattccagacaatttctgtaagaatcccagagaaaacggagccatggtgcaagaacagtacgatccattcgatcttgagcagctgctccagaaacaacagcaagaagaaggcgttcaggaacatctccttgatcaagatctccaatttcttcgactttttcgatcgattgtttttgagcatcttcagtacgctgctctgcgagtttcaaaaaatgcaccacaactgtttcgagagatttcacattgatctgaaaattaattaattagcatgaataatttgcattactgtcagtcagaataataattttctactcgcaaaagcaatcgttaaaaaaaagataacctgttgagttagagccttgtattgaaacaaagcatcttttgccaagtgttgtttcttcagatctacacacaattccatgtgcttaatcatgatttgttcgtgaacagttgtccattgcttgtgtcgtctggcctacaacaattgaaaattcaaagtttcaaattaggagcattctaaagcctaccttgatagtatcatgaagcgtgtcaagggcatcggactcttttccaacttgaatgagttcttcggcgcgtttcaatgccgcttcgggcttttgaaaataattcggagccatagttgtgctcggattaccgctgaattgagacacgaagcctgaaaattgcgaaatgaaaagaagtttacattaagaatcaatattttttttatagagcgtaattccaaatt