Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:306B4   

TH:306B4RNAiTH:306B4
PCR_productTH:306B4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZK370.5 Source_evidenceePCR752WS150 Sequence/Annotation Release
Chunk_score Abs_score647
Max_abs_score647ZK370.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII87391028741382
Overlaps_transcript ZK370.5.2 Source_evidenceePCR750WS150 Sequence/Annotation Release
ZK370.5.1 Source_evidenceePCR752WS150 Sequence/Annotation Release
WB_DNA_textTH:306B42281cctccatacacatttttctgttctttctactttcaacttaatcgtttccttttttaattcctctttttccaattctcttatcattttcatctcttatctctctttttctatcgtttttttagtatcaaaactgcaacagcacgtggggaagaagtgtgtgcgttcaaaaaggcactttgttacattgaagtgatgaagaggcgtcgtcttttttttaattcgtatcttcatagctaaccttaaacagttcgaacatcatgtgatagagatgacttggtacggcgacaatcgatattggttttcctttttcaacggcattgtgcatttcaagcttcattgatggacttgtcaagtagtatcgatcacatagaaatctgtaacaaaaaattattatatgaaaatattagctttttctgtttttttttaagtttttccgattaaaatcatgtcgctaaatttcaggtgaaatagtttcagccgttcctttatttttgcaaaagtgaaaaaaatcattaaaaatttttttgtgtttttttaaccctcaaatcaaattttctatgataattttgtaaaagatcagaataaaactcccacggaaattttctaaatcaaaattgcatattttcctccttatccctctaattcatattttcgttctttgaaatgatcaggtttgcccgaaatcacacgcgttttaaaaaatcaaacgtcatccctctccatctcaaagaacactccctgcacggaagaaaggttgaatgggcagtggtggtagagagaatgaactatgttttcaggctcaaatgacaactgacgactatgtgctcacccagagacacagcacattcaatcttcgtcgcagacggacagcgaagaactagcttatcaaaaacccaaaagacgccattcgtatagttgagaaggcctgatgaggaccagagcggtccaacggaaatttttgttaaaatttattgacttttcgtaaattttttgagaaaaatttactcagaattaatttatcacaattttctgcaagaattaagagccggaagttctagcaaagaagcaaaaaatgaagaaatggaaggtattgctgagggccttgaacatcaatctcaaaaaaaaaattttagaacattttctggtgaaactttggacttttatcggcttatttctttaatttctaggcaattttatcatcaacttgcactcaccgagcattttcaaaagcatcgtacactacactttccacatcacaggcaggatcaatacatccaacatgacgaggactttctgggagaacatttccgaatacaacctggaaaaaatgttttatttgaaaatattaaaatttttaaaataacttaccagatgttgattttgaagcatacgaatggaaattctgttgatgtaaaatcgatccaagaaatattgaattcctttttcacttgcaatatctactccatccgattctcgaagttcaatcaatccttcagccattgtttcgacgacatgtgcgtgtcttttcagtacgactgttaactgatcattgaatctgaaaaacataaattaacattaatattttaaaaatgtatttctaaacttttaaaaccaaaaaatcaagtttttttttgtaaattaggtattcaatttttcctcttaccttgcaacttgctctggagatgaatcagatgcctcgaacaaaagaagatcctcgaaactctcagcataccaatttgataccatttttgaacttggcatttgaagaagctttggtggaagaagtgtgaattcctgcataatattcgccaaacgaacgagaagctcatttttcaaaaatgtgtatgaatttgctgatgttcctattcgaccgaaatccaaatattgttgaattgtaagtgatgaaggttgaaattgactgaaaaataactttatattgaatttttcatcgaaacaagatcaaaattcactcaacagtgcagaaaaataaaaaaaaaacgacgccttagccggctaaaaataaacaaaaactagttttccctggaacaaacagaccgggcagagaacaaaggccatcgattccaatattaaaaacgatacttttcataatctcctggtttttaaagctgaaacaaatattattacctataataatcgagtttcttggccaatgaacccacgaaagggcctagtaacttccgcgaaaagcgcatctgaaaattaatttgtttttttctatttttgaaatgaaaacgagaaagtacaaagtgggacaatcaag