Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:306E12   

TH:306E12RNAiTH:306E12
PCR_productTH:306E12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F28F5.3a Source_evidenceePCR543WS150 Sequence/Annotation Release
F28F5.3c Source_evidenceePCR543WS150 Sequence/Annotation Release
Overlaps_Gene F28F5.3 Source_evidenceePCR543WS150 Sequence/Annotation Release
Chunk_score Abs_score523
Max_abs_score523F28F5.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII68140176814885
Overlaps_transcript F28F5.3a Source_evidenceePCR543WS150 Sequence/Annotation Release
F28F5.3c Source_evidenceePCR543WS150 Sequence/Annotation Release
WB_DNA_textTH:306E12869gtaccctaccaatcttttttctacagttttttagtctatcgttttgttgtgacgtcattatgccacgccaacaccacccaaatattacagacctcacgagactcgtcaccattgagaagtgctctcaaaaaatcgtcacacaactattaccatcagtcatccgatcccgtcgcaccaccaccacgacgatactattccacagaatcccttcaacttcccaaaacatcgtcttatcagagatattctgaagaagaggacgaagaaattgaggaaacatattcctcaatgcgacgtcatagacaagaaataccacgtcatgttgacgaatttcatacagtcggatcttacggggtcatgcctcaaagatccagaagtcagcaaccagctagacttccaagatatgattccgtaccggatgacgtggatgaagtcagtggagtcagtcatcgattttacgatcgttctggaaatcatgtaagagctccgcgggagcgaattcatgatattcagattcaacgagattacggtgatcgagctccttcacgtgacctggattttgttagaaacacgtacaaatgggaagagcaactagaggatacgaaagtgacaacgacgacgaaaatttatgagaaggtggcttattggtttagtgtgaaacacttttagactagaaatactaactctcacatttaaaatattgaaacttaaatcttctatactagcttgagatagactgagacttgtttgactccttttccatactttattagaggtaattttatagataaatattattttatttatttaaaaaaaaacttcatcttgtgcacttttccatccagattagaaaacacggttttccgagataa