Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:306F3   

TH:306F3RNAiTH:306F3
PCR_productTH:306F3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0303.11 Source_evidenceePCR564WS150 Sequence/Annotation Release
Overlaps_Gene B0303.11 Source_evidenceePCR564WS150 Sequence/Annotation Release
Chunk_score Abs_score438
Max_abs_score438B0303.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII87033718704541
Overlaps_transcriptB0303.11 Source_evidenceePCR564WS150 Sequence/Annotation Release
WB_DNA_textTH:306F31171actcatcgagacttgatttccacgtacaaggcatgtcgggggtgtctgacgggagagcatatcgatccatccgagataaattggtgatgggatttcaggacgagctgatggaagagtactgtaactatgaatatgaaaaattgaaaacaaatcaaatctcaccaaacaatcagatcagcatctgaactgtgttctcgaataagttccgatgcacgcaagaagcttctagtcttctctcgcaaattgaatatttgattctgaaaattcaaaattctgagtaacgcatgtgctctaatatagataaactcacattatcaaatgatccgtctacaggctcaccactgctgctggtttccaccttgtatttgtcaatttttgctcggaattcatcgtatctatagacatttttaacactttaaaatctaggaagatcttgaaactaacgtctgtttgcacggaggtttcgaaaattctggaagaatatgaagatctgaagagtcgatatggaactttcgaagaattgcagccatgttcttttgttcctcgtttatctgaaaattatccgctacagtaatccgaagtaagcttgattccaaactatttcaaatcttacgacttttgaccttaaatacggtacccggtctcgacacgatggaaactttagctacagtacccactagtgtttcgaatttgttgtttcaatggtttcatatttactcttcgtttataacgcaaaagtttagagaaaaactagataggagatattataaaaaacgaaatgctcgtgggtactgtagctgtgaagcttcggtcgtgtcgagaccggggaccgtatttcgaatctaaagttgaaaaattccagaatggcataaaagcaagttttctccaatttttttgaatcccaaaagtctgataagataaatgaacaaaccctcttattatcttttccatcagtttttgtgaatactcgaatatgtgctccttccaagaaacttccagcttgagtcaataaatatggtgcaagcattgtcaatccaccagcttcacggagccaaaacacatctgtaacatataaatgtagggtttttaagaaaatgctgcaaaattaaaacaaaaactgaaagggggagaaataaaaattaccaattctcgcgttcggaattctcttcct