Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:307A9   

TH:307A9RNAiTH:307A9
PCR_productTH:307A9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene B0280.3 Source_evidenceePCR946WS150 Sequence/Annotation Release
Chunk_score Abs_score883
Max_abs_score883B0280.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII71230847124252
Overlaps_transcript B0280.3.1 Source_evidenceePCR946WS150 Sequence/Annotation Release
B0280.3.2 Source_evidenceePCR781WS150 Sequence/Annotation Release
WB_DNA_textTH:307A91169atcaggagtattgcgaaccgccagaatggtcacctccaccggccctgaagcagaactggctcctattgagcaggcgaagaaacgagtaagtcaaaaattaagaccaattccaaccctcattaatcatttcaggctgcgtttgcctgcggtgaaaaatatgtgcaaagtggttgccgtcttggtgttggatccggaagcactgtcaagtatttggtagaatatcttaaacaaggatttcagaatggaagtctcaaggatatcatctgtgttccaaccagttttttggtaaacagattttcaacaaacccaattgttataaataagtatttcagacaaaacaatggctgattgagtctggtctccctgtctccgatttggattcacatccagaactggatgtgtgtattgatggagctgatgaagttgacggacagttcacgtgcatcaaaggcggaggtggatgtctggctcaagaaaaaattgttcaaaccgctgcaaaaaacttttacgtgatcgctgattatttaaaagattccaaacacttgggtgatcgctatccgaatgtcccaattgaggtaaattatttaactttttataattatcagtaaagaaagatgcactaaagaataaactttagaacaatagttttttctaaatagatgtagttatgttgactgtttttaatgagatttattgcaggttctacctcttgctgctcaaccacttctacgttcgattccacgcgctgaaggtggaagctgtcaacttcgacaagctgtcaaaaagtgcggaccaattgtgacagacaatggaaacttcattattgattggcagttcgagaaaaacgtatccggaagagattggttcgcgattcagcaacgattggccaatacaccaggaattgttgaaaccggattattcatcggttgcgtcgacgcagtattcttcgcgtactctgacggatctgtcaaggaaattgtcaattccaagaagcactgactacttgcatcgaattttgttcatattgaaaattagttgtttcttatcaccaccacactctccaaacttcacttttcctcttcccagttgttgtgaaaattgtacccattcattcccaatgttcctagtatacgtgtagttcttagaatagccccaataaaaattgtgtt