Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:307B5   

TH:307B5RNAiTH:307B5
PCR_productTH:307B5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR02F2.2 Source_evidenceePCR1567WS150 Sequence/Annotation Release
Overlaps_Gene R02F2.2 Source_evidenceePCR1567WS150 Sequence/Annotation Release
Chunk_score Abs_score1420
Max_abs_score1420R02F2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII54891465491296
Overlaps_transcriptR02F2.2 Source_evidenceePCR1567WS150 Sequence/Annotation Release
WB_DNA_textTH:307B52151gagtgatgcaaatctaaactttttcaacgagagagaacgccagcgtgagagacgcagaagcatggttcgtgcgagccgcgagagaagtgaatccagaagagcttcacaacaaaatctcaggaaaacgaatagtgagccaaatgtggatatgccatcggtacgttaaaaagagggacgtgagctgcatatttggaaattttgaaatctttcagatcgatgtggaagctcttcaaaagctattactttccattccgaaatttgtgtcggcttccagaaatcgaatagtaagtttttgtgaatattctagcgattacgtgtaggcaataaaacgactatgtacctgtttcctttcaaggcaaccttctcgtgccaactgcactgggctcatactaaaagactgcctaaagacgtgtctacctaccatgaagccccagaatgtttagaaatccatgcaaatttcagaaccaacggcacgattcggattccggtggagaaatgacaactgagatcgaagaactcaaagatgccgcaaaaagtattcaatccctacaacgtgtgctcgcctatccatcccaaacatcttcggatcgtggaggtaaccgtcgtctagcagatcccgtcgagtcgtgccttgaatcttcagttttctccgacgtcgacgagtcctcgctggccactgacaccatcgaaggtcgacgatctgggatctcaactcgactgggtcatccacgaggtgttatgcaatttattccatctataagaaacgatcaatttgtgcctacttccgagatacggaggaactcgatttccagaaaatcttcggtacccgatgggtttatgactagtgaaatggagtccgagccggtaccaaatgttaggaataggtagggttattatactacatgccaccgaaaatttgaaattgtcttaaacctgagttgcgtttgcattcttggtagcttacgaattcttgggattttcagatcttgactacatgatacaaacagacaaccaaaacaccattttccttcattatcatcttctacagccccatttttcagacgccgtggaatagtcgatgaaatgttctcctcttcaacatctctcctcgtggatagaccgtctgaaacccttgcaggagtgaatcggtttgcaaagcttcttgatacttttcgcagtcgacccacatccccggagcagcacccttcaatctcgtggaatccatatgtttattctgatggaggggaagctctagagacctgtgggatggaagattctttacacgaagctgacattttgttatggaagaagaggagtcgggcaagtctacgaagacattatagtgttagacaccttgctgctcgagagctgttagacactgagaagtcatttgtagagggcctagagttcctggttacggtaagcagctttcccgtgaatcaaacaaaaagaatttccagaagtacatgagacctctccgtcaaccattagaatgcacactgatcgaagcatcactggtagacaagattttctaccggataccagagattctggctcatcaccaagttttgctcactacgctgagccaacggatagatcagtggcataaagatgcaatactgggagatgtgcttctagcccatgtgagtttgaaattttaaaccttctgggctaccaagtaccgcttccactatcctttccatctaaaattctaaaattccagttctccaagcaatcaatgatagaaacctatatctcatttgtggataatttcaagtttgccaaggcatcaataatccaagccagacagaagcacgcatttgaaaaatattataatgtgagtttctcctgtcatcttctgaaacccagttcaattaaatttcagagatgctgccgagaccatcctaacaagttggacctagattctcttcttatttcaccgattcaacgcgttcctagatacgaattaatagtaaaacaaatgctgaaacacactcccgttgaacacgaggatcgagagcgactgctcagggctcagaggcatattcattgtcttgctgtggcaatcaatcagcataaggatggaagtgagcaaatggaacagagactaagggaaattgaggccatagttgatgggttggatgatgtaag