Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:307C1   

TH:307C1RNAiTH:307C1
PCR_productTH:307C1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC02F5.1 Source_evidenceePCR625WS150 Sequence/Annotation Release
Overlaps_Gene C02F5.1 Source_evidenceePCR625WS150 Sequence/Annotation Release
Chunk_score Abs_score604
Max_abs_score604C02F5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII82532348254022
Overlaps_transcriptC02F5.1 Source_evidenceePCR625WS150 Sequence/Annotation Release
WB_DNA_textTH:307C1789atctgaagatccgtccactgaacaacatccagaagctctcaaatttcagcgtattgttgaaaacgagaaaatgaaagtacaacacgagattgattctctgaattcaaccaatcaactttctgctgagaaaattgatatgttgaagactaaggagctcttgaagtttagtcatgatgagcgagaagcgattatgattgcaagaaaagacgcggaaatcaagtttttggagcttcgtctgaaatttgcactcgagaaaaaaattgaaagtgaccaggaaattgctgaactagaacaaggaaattcgaaaatggctgagcagctaagaggtctcgataagatggctgtcgttcaaaaagaactagaaaagctgagaagtcttcctccatcacgcgaagagagcgggaaaatccgaaaggagtggatggagatgaagcaatgggaattcgaccagaaaatgaaagcactccgaaatgtacgctcaaacatgattgcacttcgttcagagaaaaatgctctcgaaatgaaagtcgcggaagaacacgagaagtttgcccagaggaacgatttgaagaaaagtcgaatgctggtgttctctaaggctgttaagaaaattgtgaacttctagtgagtttaatatcgaaaaattaacagtcaaaaattataattttagatgccgccttcacccttcccttgcatcaggcctacaatacttctgatgctcatataattctttacctaatgtgccatatattttagtttttttttcatctaaaaatacccattgtgcat