Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:307C4   

TH:307C4RNAiTH:307C4
PCR_productTH:307C4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C34E10.1 Source_evidenceePCR962WS150 Sequence/Annotation Release
Chunk_score Abs_score836
Max_abs_score836C34E10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII52606195262306
Overlaps_transcript C34E10.1.3 Source_evidenceePCR961WS150 Sequence/Annotation Release
C34E10.1.1 Source_evidenceePCR962WS150 Sequence/Annotation Release
C34E10.1.2 Source_evidenceePCR960WS150 Sequence/Annotation Release
WB_DNA_textTH:307C41688aaagccaacatttaaaacctttttttttccagaaacctagtggttaatgtctgaaaagacgttccacaaggcacagaccatccgtgcaaaggcatccggagtgccttcaatcgtcgaagctgtacagtttcatggagttcgcatcacaaaaaacgatgctttggttaaggaggtactacccaaatttcaaaatgttgcacaattcaattgaaaatataaattgtgaattaaattcaacttacatgttttttcaggtttccgaattatacagaagtaaaaatctagatgaacttgttcataactctcatctggcggctcgtcatcttcaagaagttggattaatggataatgcagttgctctaattgatacatctccaagctcaaatgaaggatatgttgtcaatttcctagttcgagaaccaaaatcattcactgctggagtcaaagcaggagtttcaacgaatggagatgcggatgtcagtttaaatgccggaaaacaaagtgttggaggacgaggagaggcaatcaatacacagtatacatatactgtaaaggtaaggacgagagttggcactgccagtttggcatgttctcccaatattttttaattataaaatttggaagtataaaaaaatgtttgcttcatctaaaaatagcctttttcacatgaaaaaaattgaaaaaaagtgctcaaaaatttcagaaatttccaatttccaaacaattttggagaactttcaaaaatttttccaactgaaattaaagctatattctatcactaaattttatacaagtcttaagagaaaatgatgaagtggctcattttgtagaatttcctaaaaaataatatcttcagggcgatcactgcttcaacatttccgcaatcaaaccattcctgggatggcaaaaatattcgaatgtatcagcgactctataccgttcacttgcacatatgccatggaatcaatcagatgttgatgagaatgcagctgttcttgcatataatggacaactatggaatcaaaagcttttgcatcaagtcaaattgaatgcggtaaagtattataagtgttttgtccaaactatgatacagttcttcagatatggagaacacttcgtgccactcgagatgccgcattttcagttcgtgaacaagccggacacactttgaaattctcgttggagaatgctgtagctgttgatacaagagatagacctattcttgcaagtcgtggaattcttggtaagagtaacaacgactatttttaaaaaatatctttttcgaaaaaattacgaacgaaaaaaaactgtattatgtacccaaacgcgaaattttgcagttcttgcgcgttcttgttgataaaaaatatgtaaaaaattggaaaaactacgaaaagtcgataaaaattccgtaccaaccggaaaatgtttcattaatttctcttccttttttcagctcgttttgctcaagagtacgcaggagtatttggtgatgcgtcatttgtgaagaatacattagatttacaggtaacaaccttatttcaacaattatttcaaattctattaaaaataattccaggcagctgcccctcttccactcggtttcattcttgccgcctcattccaagcgaaacatttgaaaggactcggagatcgagaagttcatattttggatagatgttatttgg