Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:308A1   

TH:308A1RNAiTH:308A1
PCR_productTH:308A1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR08D7.8 Source_evidenceePCR579WS150 Sequence/Annotation Release
Overlaps_Gene (2)
Overlaps_transcript R08D7.4.1 Source_evidenceePCR539WS150 Sequence/Annotation Release
R08D7.8 Source_evidenceePCR671WS150 Sequence/Annotation Release
R08D7.4.2 Source_evidenceePCR553WS150 Sequence/Annotation Release
WB_DNA_textTH:308A11668caaagtattcgagtcattcagctctatcgacagattttaaaattgggcaagaattggaaagcaaaagaagaaacaaatactgtagttgagagacaacaaattatcactgaagctcgtcaggctttccgagagcaccagcaggtattctcgttctcaatattgatgtggaaactaattatatgggatttttcaggaaaaagacccaatagtgattggcaaactaatctatcaagcggagcagcgaatcgttcaagcagaacactacggaattccacatgcaagacccgaataccttcctcctgataccgcttattcagtcagaacgaaaacgcaaaattttcacaaaatgtcaagaaaacggagaactgagcgggatggtccactcagaaaaggagacaactgaactccagttcaaaagattttattgtagcgcttcaaaaattccggatcagctaatgaaggatattgtagaacaatgcataaaagattcggaatatgctgagaatctttgcaacaatgtcttcaataatgaaattgtcacatcgcatgaaattcgttacaaatttcaaataaatgttcttaaaaacttgatttctgaacttcaagccaataatgttgttgttcctgattcaatgttcgacaggcttggttctctaatgggaatgaaagaaggagaatatgtggaaagagtaagtttttaaacaattcgtcagctcaaatggaaataatttcatattttcaggtttacctaaccgatggaggcgacaaagttctagcgaaattctcggaagctgtaaatcaactatcaatgggtacaactggcttatcagtttggcaagcttcttgtgatctcgccaatctttttcgcttgattccctccgagtacaatcgaatattagaactcgggtcaggatgtggtgttagtggaattgcaattgcaaaaatgaatgattgttgtgtgacgctcactgattatgatgataatgtgctgaatcttttagaagagaatattgcgaaaaacgatctgaagagtgatactgaaggtattttttgagaaataaaatcgactccttccgtatttcaaatttaaaaatatttagaatctaaattgtagattcgtcagccaacaacaatcaagcaacagttcgctcactcaattggtgtgattttgatttctctgaatggaaggaacccacggatttgattatcgcggccggtaggttttgctaatacttttatttgttaaattctttgtttttctatatgatattcgtgtgaaacgaaacccttcaaataacagcttcaggcactcattatccaagtcttctcatttctctgtgtctctcttctctttcacgtctcctttttcagatgttgtctacgacactgcattgctcgcctctctctgcaatgtgctcaatcttctgctccgccactcaaaagctgctatcgttgcgtgcactcgtcgtaacgagtcgagtattgagtgtttcgagcatcatttgagttagttatttttctttcgtacacaatatttttctattcactatattttttacagaaatggcaaaactagaaattgtggaaaaattcgaatacgaaaacggtgcctacacaattggagaaaattcgtatcattatgcatctattttcccatttttctcaact