Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:308A1   

TH:308A1RNAiTH:308A1
PCR_productTH:308A1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR08D7.8 Source_evidenceePCR579WS150 Sequence/Annotation Release
Overlaps_Gene R08D7.4 Source_evidenceePCR553WS150 Sequence/Annotation Release
Chunk_score Abs_score511
Specificity_index0.468
Rel_score0.878
Map_statusTop50_percentile_ePCRIII89718518973518
R08D7.8 Source_evidenceePCR671WS150 Sequence/Annotation Release
Chunk_score Abs_score566
Max_abs_score566R08D7.8
Specificity_index0.532
Rel_score1
Map_statusBest_ePCRIII89718518973518
Overlaps_transcript (3)
WB_DNA_textTH:308A11668caaagtattcgagtcattcagctctatcgacagattttaaaattgggcaagaattggaaagcaaaagaagaaacaaatactgtagttgagagacaacaaattatcactgaagctcgtcaggctttccgagagcaccagcaggtattctcgttctcaatattgatgtggaaactaattatatgggatttttcaggaaaaagacccaatagtgattggcaaactaatctatcaagcggagcagcgaatcgttcaagcagaacactacggaattccacatgcaagacccgaataccttcctcctgataccgcttattcagtcagaacgaaaacgcaaaattttcacaaaatgtcaagaaaacggagaactgagcgggatggtccactcagaaaaggagacaactgaactccagttcaaaagattttattgtagcgcttcaaaaattccggatcagctaatgaaggatattgtagaacaatgcataaaagattcggaatatgctgagaatctttgcaacaatgtcttcaataatgaaattgtcacatcgcatgaaattcgttacaaatttcaaataaatgttcttaaaaacttgatttctgaacttcaagccaataatgttgttgttcctgattcaatgttcgacaggcttggttctctaatgggaatgaaagaaggagaatatgtggaaagagtaagtttttaaacaattcgtcagctcaaatggaaataatttcatattttcaggtttacctaaccgatggaggcgacaaagttctagcgaaattctcggaagctgtaaatcaactatcaatgggtacaactggcttatcagtttggcaagcttcttgtgatctcgccaatctttttcgcttgattccctccgagtacaatcgaatattagaactcgggtcaggatgtggtgttagtggaattgcaattgcaaaaatgaatgattgttgtgtgacgctcactgattatgatgataatgtgctgaatcttttagaagagaatattgcgaaaaacgatctgaagagtgatactgaaggtattttttgagaaataaaatcgactccttccgtatttcaaatttaaaaatatttagaatctaaattgtagattcgtcagccaacaacaatcaagcaacagttcgctcactcaattggtgtgattttgatttctctgaatggaaggaacccacggatttgattatcgcggccggtaggttttgctaatacttttatttgttaaattctttgtttttctatatgatattcgtgtgaaacgaaacccttcaaataacagcttcaggcactcattatccaagtcttctcatttctctgtgtctctcttctctttcacgtctcctttttcagatgttgtctacgacactgcattgctcgcctctctctgcaatgtgctcaatcttctgctccgccactcaaaagctgctatcgttgcgtgcactcgtcgtaacgagtcgagtattgagtgtttcgagcatcatttgagttagttatttttctttcgtacacaatatttttctattcactatattttttacagaaatggcaaaactagaaattgtggaaaaattcgaatacgaaaacggtgcctacacaattggagaaaattcgtatcattatgcatctattttcccatttttctcaact