Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:308E4   

TH:308E4RNAiTH:308E4
PCR_productTH:308E4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK652.5 Source_evidenceePCR845WS150 Sequence/Annotation Release
Overlaps_Gene ZK652.5 Source_evidenceePCR969WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII78396787841744
Overlaps_transcriptZK652.5 Source_evidenceePCR969WS150 Sequence/Annotation Release
WB_DNA_textTH:308E42067actgaaaaccatctgtcaaacacgacaatcatccgattttcattgctgataagctgatttcgggaatgatgatgataagatttgttagacttattcaaaaatcgagaaagatgagaagctgtatggctgacatatcattttatgaattcagacgttcttcaaacaattgctgctttacaagcctgtcccacatcctgtataccttcaacatcaactggaatgctttcaccgaatcttcccttctcggctacaattccacgtgtcaacttgttcccaccatcacaaccagccaattctttaatactgccaacaattccagcacaggtgaatgattttcgtattttcaaaaaacctcttaaccccttttgtattttcagccttttattccaaatccatctctcctgcaagccaatccatctgctgtcgaagctcttgcaaatgcactttttgcaacaacaagccgtcgggcttcttgcccagaacctcctgcatcctctcaagcaaccgtcacgcttcaagtcccatctacgggttctccagaacgacgacgttattcagaaacaaatatggaggttctgctacgtgaacaacttgcacaattgatgcctccaacctctcaactacccggaatgcctggatgttattatcaacatgttccagctgctggaacttcaggaattcaaggatcattagatgcggcgttaatgggagctgttcccttggctatgaatagtatggcacatagtcggagagcagcaaatcatagaaaagcaaggtaaggagaataaaccagcaaaatgacacatctttgtagcatactctatcaactttttatcaatctttagcacaaaatctgcagcttttcagaaaagagctttttgacaaattttcatttacatttctttgaagctgtggcgttttttttcgagaagaagagcacaatatacttgtatactggcttctcgcctcaaaaattgaacaaaccagtttcagaaaactttcataaaaaaagtcagaaaaattgtcaacgaatcatagaaccatcaggtgactcatttaagattttataagctttatcaaatcctttgacgaaataaacatttacttcatttccgaaaggaagttttttggcctctgacttgaagtttttaaaaatataatttatttatctttagaaattcttaatcaatctaaaatataactttgacgcaaaacgaagttcgtgggataattcatacgtgccgaattgaaaagaaattgttggttcccacagtaagaagctgaagaagattgttttaagattctaaactaaagatcaaacaaattcaaagttttcagaacaatctacggtacaacacaaactcaacaactggaagatatgtttaaaggacaaatgtacgtagtcggagcagaacgagaaaatcttgctcaacgccttggcctatcaccttctcaagttagaatttggtttcaaaaccggagaagcaaacatcgtaggaaacaacaagaggagcaacagagcacgacgttagaagaaaaatctgaagaaattggaaaagatgaagaggaagatgatgaagaagatgaagatgatgtaaaagttctgaattaatttaattttttttttcgtgtttacttgtttatttcctgccatattctgttttagaaaataattagaaaaaatgtgtatattcttgattataaagcattaaacaaataaagttttatgtgaacttacttgataggttacgttatcaggaaatggttcggtgcttcaaagaaaatgtgaaatcttacaagaaagcttagcgaatggcttcaattttttctaactcaataaataatcaatattttacaaaaaaagtattgcgaacaagaggtaaaatatttctgatcactttgttagttgaacatttggtttttagacgtgtatttttccagatacgccagtttgaagatacgcaatttagcgagtccttgaagttttgtggatatatttaattttgcatacgaccaacttttgaaaaaaaaacagtaaattccactgaacaaaccgtaattttccac