Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:308E6   

TH:308E6RNAiTH:308E6
PCR_productTH:308E6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC35D10.3 Source_evidenceePCR597WS150 Sequence/Annotation Release
Overlaps_Gene C35D10.3 Source_evidenceePCR597WS150 Sequence/Annotation Release
Chunk_score Abs_score513
Max_abs_score513C35D10.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII48688784869970
Overlaps_transcriptC35D10.3 Source_evidenceePCR597WS150 Sequence/Annotation Release
WB_DNA_textTH:308E61093attcatttccacaatgacgtgttcagttggaatgattggtcaattttcaaggtttggaatagtttgtgttaatgggcattatgttggggtatttcaaggcttaacatttagatagccagcgtatgtcatgatgtattgtgtaggcataaaatgcctgcttgatttcctacaagaaaacctagatctattgtgtaccaacccgcaaaagctctcttttgtagtaggcgaaaggtaggcatgtgtgccttgagacaaagctgttgctttcttctcaggatttgttccatattcttaagaattagaagcttttgtgagaaaatttaaagagtgtaaacttctatcaaacttctcttttttcagttacgcaatatgcagcccaaacttatggatgattgttgcttgtacatgcatgacactccttacaatgcttatgacgttatatatgaattgcgggtttcgaaggaatgtacgatggctgaagttcactgagtggaaggtttgtgttcattagatcagattgttagtgcaggttcaacgtatcttccttttcgggccctgcctaaatatttcatccgaccgaggcgtaatgatcattgatgatcacgtaatcgccatcctcttgcaataggcgccttccggtcgagaggggtgagcgtgaattgtgaagctcacttctattcatatttcagctccagcaactcgccgaacgtctccgcattcaagagccaaatgtaggtcttcttatgcaagtaaccagaaaagtgaatgataagaagaacagtgataagaaagaattcgactttttcaacaatcgagatcaaaataacaatatcgcaggagcattgaatgaagtggcaagtaagacaagtaatggctcaatgggatcaacggatgtagttgctgctcaaatcagaaaggcgagagatgaagacgtagagaaagtgttgcgggagagtaatatggatattcttactcctgatgtgtatgttttaagtttgaattttctgaaaatgattatattttcagccaacccactcaaccaagcactggaggatctcagaaaattctgaaaaagtggacaggagcaacaata