Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:308G3   

TH:308G3RNAiTH:308G3
PCR_productTH:308G3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C35D10.1 Source_evidenceePCR603WS150 Sequence/Annotation Release
C35D10.16 Source_evidenceePCR293WS150 Sequence/Annotation Release
Overlaps_Gene C35D10.1 Source_evidenceePCR605WS150 Sequence/Annotation Release
Chunk_score Abs_score542
Max_abs_score542C35D10.1
Specificity_index0.722
Rel_score1
Map_statusBest_ePCRIII48789814881164
C35D10.16 Source_evidenceePCR293WS150 Sequence/Annotation Release
Chunk_score Abs_score209
Specificity_index0.278
Rel_score0.386
Map_statusBottom50_percentile_ePCRIII48789814881164
Overlaps_transcript C35D10.16 Source_evidenceePCR293WS150 Sequence/Annotation Release
C35D10.1 Source_evidenceePCR605WS150 Sequence/Annotation Release
WB_DNA_textTH:308G32184caatcgccatcaaacaatccgacgaaatcgagaagattctgtgccacaagttcactcgattcatgtgccaaagagccgataacttctttgtgctccgtcgcaagccactgccaggtcagaattaatactaatattcagagattaaagcgataattttaggttatgacatctcgttcctcatcacagcatctcacacagaagcaatgttcaagcacaaacttgtcgactttttgcttcattttatgcaggaaattgataaggtgaacattttaagttaatttttaaaaaattccataaatttccaggaaatttccgagatgaagctgtctctcaacgcccgtgcccgtgtttctgctgaagaatttttgaagcgtttcaattaattttctccccatgattcccaattcatttttctcattttcactcaaattccgaagactttaaactattatgtgaacacggttttttgatcaatttgtgtaaatatcatctttattctcaattttttcactttttgtttctgaaaatgactcccctcccaaaaatttcctgttttaggtcctattttgcctttttgattatcgattttttttaccgcacactgactttatgaattatttattcaatttttgcaatatgtatgatctgaaatatctcgtgaaacatttacgagctttaatattttaaaatgattattaagttggaaattgacaaatcaatttcagaaatgaagtctattctacttttattctccctgatagtgctcggcagtgcaacagaagaagtgagcagaactgagcaaacatcgacattattctccgtcgaaggcgaggttcgtataccaaaaatgtttgatttttggattaaaaatatcgatcattttggctatattcatagagaagtcatattataaattaagacaacgtttatatgcttctgaatactttttccagttctcacattttttaaaattttatcttctaggttcctattctaataacaacaaattcgttgtaaattaaatatttcatagtcctcaaaaaaaaaatttcagatcgcacttccatctactcgaaattgtgcaaaatggtccgcaggtgctcgtattcatttgaaccatggccaatatatgggatttgttcgtcaagattgtacattccgtgttgatttcgtgcctactggaacctatattgttcaaatcgaaaatacagattttgtctttgagccaattcgcgttgatatcacatcaaaaggaaagatgagagctagaaaattgacaattcttcaggtatattgaatttcggaacaaatcaaacaatttcgatcgtaaattattaactaccgggagaaaacggttaaaatcggacgtagctcctccgaacgtgtgatgaaaaaatttttttttaatcctctgtttatcatgactgcgtcgtagttttttttgcaaattaatatataaatatagagaaatatttgtaacttctgataaaaattttactttcatttgaaagttttcagaagctgctccaaaactaactaaaaaatatcgatatgccgatcgccatttgacatttgacacattgcgactttgaggcatttttaaaaataaattttcaattaaaagtaaaattatttgcagaaaaacgaatatttctctaaaattttatttgtataaatgtgttataaaaacttggacacaagatgagaaaatgactgttttaggaataagccgtattgtttcgcttcgaatcttttataaaagttctaacttggaaaatatagatatagacattctgtgcagaaaatctcaagaggcccttaagcagttcttctgagttatttgaaactttctttcaatcttcataactttcagccgaacaatgtcaacactctcccatatccactccgtttatcagcacgaggtcctgctcgttacttcagaaaacgtgaagaatggagaatcactgatatgctgttcagtccgatggttttgatgctcgttgtgccacttgttgtcatgctaattcttccaaagtatgcttcctcttaaatcgctcatctgcaaaattccaaattttcagaatgacagcaaatgatcccgaactcaaaaaagaaatggagaacatgcaaatgccaaaagttgatatgccagatgtcggtgaaatgatggctaacttctttgga