Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:308G6   

TH:308G6RNAiTH:308G6
PCR_productTH:308G6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C26E6.7a Source_evidenceePCR1852WS150 Sequence/Annotation Release
C26E6.7b Source_evidenceePCR1858WS150 Sequence/Annotation Release
Overlaps_Gene C26E6.7 Source_evidenceePCR1858WS150 Sequence/Annotation Release
Chunk_score Abs_score1669
Max_abs_score1669C26E6.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII49326354934915
Overlaps_transcript (2)
WB_DNA_textTH:308G62281ggttgtgagaaaatcagagaagtacatataaatataagtctattcttcatctggatcaaaattgcaggccagcttcaaaaccaccgactcccgaggtagaagactgcacattttctgaaaagaacaatgatcaaagaaaaattgaaaaagaaacagaatcagaagaatcgagtaatttgaaatttccgcctgctcgaccatcaattcggaatgcgacggtttgtttgtatcatgttaattagaaaaatgtattactatttcagaatttccgccgaataatttgtatttctgaatcagatagtggaaaggaagagccggtagtgaagaaggaagtcttgaaaacaaataaactcagaatatctgaaacgaagcccgagtatcctccagaacttctacaacttgaagcaagactccaggaacttcgagctggccgaaaaaataaacaaggacgagtaagctgtttttaggttttcaatagtttattgaagatatattttgttttagataaaccgcaagttcgtggctaaaccctgtggagttgtgagtggagagacacctcaacgtccatttcttgaagaaatgtattatttcaatcctcaggaaactggaactgcgagcgagattttcgacatgcttttccctgcaaagtaagccttttcaatatagagtgaatatattttttaattaaatacctttgacaagtttcagagatactccaaattttcgcccatggcttgatgggcacttttcggctccagatttgcagttcaaacaaatagaaaaacaacgacaaactaaactccattcatacacagggaccacgttacaagaaaaaaaacgcaaaaaacgaaaaaaaatattgaaaagtattcaagaaatattgtggcttctacacttccagaaacatgatgatttcttggaatcaacgagtcgcctcacaattaagaacttttcatgccattttgatgaacatcagcggcttaaattgctgcgtaacaacgatttatcattaatatgtaattatcaaatcggatcagaaaatactccaatttttaaccaaagaagcacggattgtatgcttagacccgtatttataggttggttactttcatatttagatgtttttaactttgaataattcgtttcagatggcttatcattcatggacatgctaattccgatctcatcgtcgcttccaataatttccacgagatctctacttgaaatacttttaaatttcattctagacgggtgccaaactgtaatatacttgccagattattataacgatacaactaaccaaaaagtcgatgactcgactatttttcaattcttgtgcaattcaaaacttatacagtttgttgacgggcggagtcggagggctgtggaacgacaagtattgcttgaagctgaaaaggttattcttttagtttcaaaattcgttaatttgaaaataaattttaggtccatggagtctttgtttcctcagcggaagagtttctaacccgaaacgctattcaatgctttccagtgattaatcgttattctaaaagacttgatgaatttctaatttgcacagtattcctagtcaataatcttccgaaaaaaatactcgcacaagatttcgttgaagaatctagagttttgaaacctgaagggagttcttcagccgtatcaagcacaactgtcctagaagaatcacatcaaaaaatcagtggagctatggaagactctgaggatgaacctgctgatccacaaacgttgaaacaagaatatttgattaaagaggaatgttctgaaatatcagaagattctgaagaaggagctatcgtcgatgttgcttccagctcaggcgacttatccgaaaacgtaggtgcaatctaaattttgtaaagtctaaattttttcagcgtgatcagaaatctgaaaacgaagaatttgaatattccccgcatcagttaactcttgagcaacaaacatatttggttattttttccagttttccgttcagattgatttatcatcaatatttcagatttcctctatggcgcaactctctattttccatttccaacgctatcgccaaataagagtattccttatgattataaaacgttacgtgccagaacttttacctagttttatgcaaaaaactcgcatggatgatgttgctatggcaattcaagacattcagaacgggaaggaccttctttattggcctattttctcaaaaattgataattaatatgttcaataaaaatattttcgcatttctttggtt