Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:309B10   

TH:309B10RNAiTH:309B10
PCR_productTH:309B10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF31E3.6 Source_evidenceePCR110WS150 Sequence/Annotation Release
Overlaps_Gene F31E3.6 Source_evidenceePCR170WS150 Sequence/Annotation Release
Chunk_score Abs_score128
Max_abs_score128F31E3.6
Specificity_index0.421
Rel_score1
Map_statusUnique_ePCRIII69818866982654
F22D6.7 Chunk_score Abs_score92
Specificity_index0.303
Rel_score0.719
F22D6.6 Chunk_score Abs_score84
Specificity_index0.276
Rel_score0.656
Overlaps_transcriptF31E3.6 Source_evidenceePCR170WS150 Sequence/Annotation Release
WB_DNA_textTH:309B10769cggtgaaatgaaaattgctagtttccttcttactattgagtattcttttttttctttttttttaaacacatatatttttgtcagatgttctctattttttaaatttcaacttttgataaaaaaaaattacaggaagtgtttctaatgggatgatgcaagtgaatttctcgtcatttctcgacaatttttttgcaatgcaagtgtgcggagaaatgacgagaaatgacgtgaaattcgcaatttctccgcatttctcgacatccacacataccgtagttggtgacgttgttggcggcaaatcgcggcgagacccgctgtgtcgatttacgaggatatagctaatgttagtttttcccaataaacttggtttttctgtcgttcttgttcaattttcgtgatcttttcgcagtttttactctttttcatgtatatttattgaattcaatattgtacttttcaattctctgcgcagtcaaacgtcatttttagttttatagctattttcggtggcttaaagaaaaaaaattttaattttctttttcagagctcgatattgctccagtcaggatatgatttgttgatgtcgtcagcgcgatgaattccgtcacataaaatatgcacaaaatcgtcaataacgatcagaacaagatattggtcatcgcgtaagttcaaaaagtgaataactggattatgaatataatttcagaaagtcaaatgctcaatctctgcggaagacttttctacactcgtgccttctgaaaatgtcgct