Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:309F12   

TH:309F12RNAiTH:309F12
PCR_productTH:309F12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C06E8.1 Source_evidenceePCR465WS150 Sequence/Annotation Release
F11H8.2 Source_evidenceePCR57WS150 Sequence/Annotation Release
Overlaps_Gene C06E8.1 Source_evidenceePCR533WS150 Sequence/Annotation Release
Chunk_score Abs_score512
Max_abs_score512C06E8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII70084297009256
F11H8.2 Source_evidenceePCR57WS150 Sequence/Annotation Release
Overlaps_transcript C06E8.1 Source_evidenceePCR533WS150 Sequence/Annotation Release
F11H8.2 Source_evidenceePCR57WS150 Sequence/Annotation Release
WB_DNA_textTH:309F12828gccgttctatttcggattcttgaaaactagactacgttctaggataatttttcgtcttgagaatatgagtttctgaagactgatactttggtttgttatgttttatggtcacatagccaaattttgtttggaaaagaatcagaatctaataattttcttttattgaaaactttgtttcttgggggatttttccgatacattttcaaaattgaattgatttttcatcaattttttaaattttccaatacaaactttttacaattggagtgatgttggatgtacaaaaattcagtgacgtcctactatataagaaacaaaggtcattctcttacattgtttttcttgcactgacttttcacctttattgtcttttcttttcttctcaaccatcatgctcctgcagagataataaccctttttttgcttccaacaacttccagaatttcgaaaaatttacacgcggaattcagaagaggacgtcatactcgtgtcttcaacttcttctaccgccaccatcgtcggacacagaaacacacaagaccgccctctcctctcatgttttccggttgaaaaaagaaggagcagaaaagaaatgggcggagcttcggacgggtgctctcggtggcgcggagcacatgcacacacatacgcttcgaccccttcttctggctcccgaggagcccaacaccatcaccaccatcaccatcattgagtgtgtctactcatattggtgacagaagatatgatgacgtggctattatggtcactactcattggttatgtgacaacagaacatccaccggtaggtagggtacggtattggaacac