Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:310C11   

TH:310C11RNAiTH:310C11
PCR_productTH:310C11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F09G8.10 Source_evidenceePCR376WS150 Sequence/Annotation Release
F09G8.9 Source_evidenceePCR276WS150 Sequence/Annotation Release
Overlaps_Gene F09G8.10 Source_evidenceePCR701WS150 Sequence/Annotation Release
Chunk_score Abs_score617
Max_abs_score617F09G8.10
Specificity_index0.763
Rel_score1
Map_statusBest_ePCRIII82704688271820
F09G8.9 Source_evidenceePCR276WS150 Sequence/Annotation Release
Chunk_score Abs_score192
Specificity_index0.237
Rel_score0.311
Map_statusBottom50_percentile_ePCRIII82704688271820
Overlaps_transcript F09G8.9 Source_evidenceePCR276WS150 Sequence/Annotation Release
F09G8.10 Source_evidenceePCR701WS150 Sequence/Annotation Release
WB_DNA_textTH:310C111353aagttgggcgaaaaattccaaactattaaggccaagcttcttcaaagtactcagttatctatatttcagaatgtactcctctgaaaattgaacctctttttgttgctttaacataaattaattgcgggtgaattataacacttctgtttgacaacaaaactaacaaattttaatttctaaaaacttcatagtcagaaaaaaaattaaaaaataacttaaaataattatcaaaatcttctagtctgttctctgccaaaaatttgttctcgggtaatagacacgatgctttggatctgaaaattagtattttttataaataccaagtaatcatgtgtagtcagagtattccatagttatttagcgtctgaaacatgtggtaacctcattttttggcagtaggacgtctcaggcccgtaaattaacacggagttcggtagagcgtcgccaactttcgcggtaacgtaatatagaaaataagaaaacagcgacgtcataattcctaaaaaatgaggctgatatgttttccaaagcccagaccaacactctatatataaaatcaaatatataaagcttaccaggccgagaagaattcaacaaaacttcaatccaaataagtaaatatactagacaaaggaacacaaaagtcatgatgatgacgagtagaaaatcaaagtatttggtaggataggagatgctgaaatttgttttttaaatcttaacaaataagaaaaagaaaaattaccgattacatgaggagctccattgaagaaattcttcaattaggtatttataattgaacgaagaactggcgtagttgttgatattttcttttggaaaagtcatggtttttcagaaaagaatatcaaaaagtaaattttataaaatattaatttcaaaattgtgcacataacgtgacaatacataatccacattctcttttacaatatgcacatgctccttgttgctcttttccttctttatgtattttatccggaatcgtcacgattgttggctgaactgtaattggagcaattttctgagatggcagttttggtttctgtggttttggtggcggcgaagaagctggaagttcgggagaaggaagtgcaaatttcactttcttttcaggttccagatcttcttttgttgtttcggtagttggttttcgaaccggagatggtgttcttctataattgtccccaattggacctcgatcgaaatcagttagagttcctagttcagaggctaaaaagttaaaaataaacaagttgaaatacaagacccatgcttctgagattgtggccgacatattaaaagaaatcgatcatacattttggacaacaccaacaagca