Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:310E12   

TH:310E12RNAiTH:310E12
PCR_productTH:310E12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C14B9.1 Source_evidenceePCR475WS150 Sequence/Annotation Release
Chunk_score Abs_score413
Max_abs_score413C14B9.1
Specificity_index0.812
Rel_score1
Map_statusBest_ePCRIII81380408139651
C14B9.8 Source_evidenceePCR106WS150 Sequence/Annotation Release
Chunk_score Abs_score85
Specificity_index0.188
Rel_score0.231
Map_statusBottom50_percentile_ePCRIII81380408139651
Overlaps_transcript C14B9.1.1 Source_evidenceePCR475WS150 Sequence/Annotation Release
C14B9.1.3 Source_evidenceePCR472WS150 Sequence/Annotation Release
C14B9.8 Source_evidenceePCR106WS150 Sequence/Annotation Release
C14B9.1.2 Source_evidenceePCR474WS150 Sequence/Annotation Release
WB_DNA_textTH:310E121612aatgtccgctatcgaggtgaccgctgacgccgcttccacctgggattggccacttcaacacaacgacggagttgtcaaggttcgggatattttttctctttaatagaaggctctgcaatttttatgagccaaaatttaataaaaacgctcattttttctttttggttaaatttggaatataaaccaaccacgacactttagtaacttagactacctactcttgaaaaaataaaacaacaattttcgaatgacgctacagtacccctaccttaacactacttcataggaaacgtaatttttgatattaataagttcacaaatatatagtaaatcatcaaatttatcaatacagtgaaaagatgttgtaatatgttcagaaataccttagaaaacttactatgatcgcaatagaagctgtatcaaaattaaagaaaactatatttattttgatagcttctatctggattttcgataaattgcatttgtatactggaatgaataactagaatagattatgagtttttcatataagcatagtttcaaattacacttgaaaaatcagcatgttctgtaatcatatagacacactgtaaaatacagtactcttcgcctagagacgaagagtacagtagtttacagtgtggaaaagtactctgacagtcgtaatgttaactcgtgtaaattctgactgaatattcttaaatttcaggtccacaacaccaaggaaaagttcgaggtcggacttgacgttcaattcttcactccaaaggaaatcgaggtcaaggtttccggacaagagcttctcatccactgccgtcacgaggtaagagttataattggtatttataaaattaggaggctcctttttcgacttcaactcactgaaacttacccattttctgaattatataaaatctaacaaaagaatgatacctatggtagcattgaatatttgttccaaaatatcaaattataaaactaaatacagtaatatcgtccttcaaaaatttccactgaacatatgacgtagtagttaaaagacaacaatatgaaccatattttgggtctcgccacgcggacaatgatttacagaatgatttacagtagctcgtgatgccgtatcttctttttcaacttaagcagcacagatttgtttaaagaaaaatatgctgaactagatagataattcttataaatagaagattaattgtataactctcaactttccagacccgcagtgacaaccatggaaccgttgcccgtgaaatcaaccgtgcctacaaacttccagatgacgttgatgtttccaccgtcaaatcccacctcgccacccgcggagttctcaccatcactgcttccaagaaggcttaaatgtctagaacatgattacaaccaaaaaaaacaatatttttctcaattgaataatatcaaattattcttcacttaaatactttacatttctttttgactaatcaaatattgcaatactttcaataaatgtacgactttatgtgtttatggaaaaatgctataaaaagaaaatcatttaaaaaaatacaaattagaaaaatggcaagatgcaagactagaccattggtgatggctgtgagaa