Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:310E4   

TH:310E4RNAiTH:310E4
PCR_productTH:310E4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene (2)
Overlaps_transcript K12H4.5.2 Source_evidenceePCR6WS150 Sequence/Annotation Release
K12H4.4.1 Source_evidenceePCR572WS150 Sequence/Annotation Release
K12H4.4.2 Source_evidenceePCR572WS150 Sequence/Annotation Release
WB_DNA_textTH:310E4779cgcactcctagcgttcactctttgggtgatggccgcagtcacagcagcttgtttcctgtcaacagttttcctcgactacactgttccaaccaagctcactgtcaacgatgtcaaagtgtaggttttataagagaaataaaaaaattgcgaaattctttcaagcgtttctccgaaaacattttaaacgtatttctgtaaatcttattccattttcaggagaaacgttgtcgactacgccacggatgagcaacaagccgatctcgccacactaaacttcaatctgaaagtcgatttttcaaagattttcaactggaacgtcaagcaattgtttgtttatttggttgcagaatataaatcgaaagtcaacgtaagctttggaaacttttattgaggatcgaaaaaaacttctttttttttgcaattgtaggaggttaaccaagtggtgctatgggacagaattgtggaacgtgctgaccgtgtggttatggacgagatcggtgtcaagtcaaagtattatttcctcgacgatggaaccaatttgcttaaccacaaaaatgtcacctttgttttgaggtttgaattgaaaattcgataaataaaaccaaatattaaaatatttagatacaacgtgattccaaactctggctatcttcgtcttgttcaatcttccgatcaagttgttgttccgttcccaaccacatacacaactactcgaagatcctagttacatcttattttacttgtttcatatgaaatactatgggttatgtgtttcatcc