Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:310F8   

TH:310F8RNAiTH:310F8
PCR_productTH:310F8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC395.7 Source_evidenceePCR555WS150 Sequence/Annotation Release
Overlaps_Gene C34E10.1 Source_evidenceePCR268WS150 Sequence/Annotation Release
Chunk_score Abs_score248
Specificity_index0.333
Rel_score0.499
Map_statusBottom50_percentile_ePCRIII52635275264922
ZC395.7 Source_evidenceePCR624WS150 Sequence/Annotation Release
Chunk_score Abs_score497
Max_abs_score497ZC395.7
Specificity_index0.667
Rel_score1
Map_statusBest_ePCRIII52635275264922
Overlaps_transcript C34E10.1.3 Source_evidenceePCR268WS150 Sequence/Annotation Release
C34E10.1.1 Source_evidenceePCR268WS150 Sequence/Annotation Release
C34E10.1.2 Source_evidenceePCR268WS150 Sequence/Annotation Release
ZC395.7 Source_evidenceePCR624WS150 Sequence/Annotation Release
WB_DNA_textTH:310F81396gaaatatgtgctcggcgattcattgctcggtggattccatattggagctggtgtcaacttcttgtagagattaattggatgcaagcacccctcaaaaagatttttttgaaaaacgataaattcacagaatttcagttctttttctcccccttttattgttattttcatcgtaatgctgtgctagaagtcagagtaaatatgagtttttttgtgttctaggaattccattttttcaggaagcaaatttaataaaaattatcgaatttcttgctctaaagatgttgtacattttatggaaatgttcgtatagtaattcgaacactttatatttctcgttttaaaactgtcggtgttttatagtaaactatcttcagaaaaaaatgagcctacgaaaaatcaatttcgtaactggaaacgtgaagaagcttgaagaagtcaaggctattttgaagaatttcgaggtaaaatatatttgatattattcgaacgcgaaattttgcgccaaaagtacgatgcctggtctcaacacgacaatattttgttaaatacaaacgaatgtgcgccttcaaagaaaagtttcaatctttcgttgccgtggagatatttttagagtttttgtttaaattatatatttgtcgtatcgaaaccgggtaccgtaatcaatcaattaaatattttcaggtttcaaacgtggatgtcgatttggatgaattccaaggagaacccgaatttattgccgaaagaaagtgccgtgaggctgttgaagctgtaaaagggcccgttttggtatggaaaattgtatttgttctaaaaattgtcaaatttcaggtcgaagacacaagtttatgcttcaacgcaatgggcggtcttcctggaccttatatcaagtggtttttgaagaatttgaaaccagaaggactacataatatgctaggtaaatattttaattttttgaaaaaacttatttttcagccggattttctgacaaaaccgcctatgctcaatgcatctttgcgtacactgaaggactcggaaaacctattcatgtatttgctggtatgattttttgaatttaattctttaattttatatgttaatttagttgtttcattcctcaatttatgagagatttttttttcaatttttctatttcaggaaaatgtcctggtcaaattgttgctccacgtggtgatactgcttttggatgggatccatgcttccagccagatggttttaaagaaacattcggagaaatggataaagatgtaaaaaatgaaatttctcatcgtgcaaaggctctggaactcctcaaggaatattttcagaataattaaattattttttctcatctatgcaatttcttgaaaatttgttaagtttccgttgttatgcattt