Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:310H4   

TH:310H4RNAiTH:310H4
PCR_productTH:310H4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS K04C2.8 Source_evidenceePCR465WS150 Sequence/Annotation Release
R13F6.1 Source_evidenceePCR450WS150 Sequence/Annotation Release
Overlaps_Gene K04C2.8 Source_evidenceePCR465WS150 Sequence/Annotation Release
Chunk_score Abs_score423
Max_abs_score423K04C2.8
Specificity_index0.517
Rel_score1
Map_statusTop85_percentile_ePCRIII68694546871225
R13F6.1 Source_evidenceePCR500WS150 Sequence/Annotation Release
Chunk_score Abs_score395
Specificity_index0.483
Rel_score0.934
Map_statusBest_ePCRIII68694546871225
Overlaps_transcript R13F6.1 Source_evidenceePCR500WS150 Sequence/Annotation Release
K04C2.8 Source_evidenceePCR465WS150 Sequence/Annotation Release
WB_DNA_textTH:310H41772aaatcaaagcctttccacgttcgaacgttccaacaaataaaattatcggaaaatgtctcatttatgatttttttaattttcaattggtttgaaaatgttgtttacttttttccagagaaatgacaactccaagtcctcaggaaatatcaactgtcacattgaactctttgtcgaaggaagaacgaaagaaaggtgagtttctgaacagattaatcattatttattctgtttttagcaattctggccttacaaacaaagaaaaacgaaatcaaattagttattgatgaacatcagaagaaattagctgagtttcgacaatcgattcctgatgggtgctgtgaaatgttcgaaaacgaaaagaaaattcgtctgaaacatagtgtaagcttttttactcaaaaaattgcttctaaataaattcgaattttcagtccacggccgaacttcttccacatttacaaaaagtaggctcgagcagtgtcgacaaagagaaaatgatcaacaacattcggcaaagagttgaagttcaagttgctgaccaggagacttttaagagtatcgaagaacggaatgaactggtagtataataaaaatttgtatttcttaaaataaatatactgatttcagttgcgtcgagaaaacgagaatctcaaaaaagaagtcaataccgtggcagccgaactcctgcaagaatttgaaagttatgaataaacttgtgaacatttattttcgataccacgtgtatttctcattaaacattttcatccacatttttattgtatcaattcatttcttttaactctctaataaagatcatgggattcaaaaaggatgtgcaatttcttggcaatctgccggtttctgaaaaattggtcggtttgtgtgctgagtggatcttcattttttaatcttttcagataatatcctccggaccgataatcgtttatactacacacggctgtaagattaataactttcgtgataaatttgaggtatggtagccacctgggtaatatcaataattcatttaatttagataatgcatgggtggtctccactattgttatcaactgcgaaatgttttactagactcatcatcagtaatatgcaagaaccagtatgtgctccgattatttggaaattgaccgtaaacgtggtaaaataacccaagacaagcctatgagttcaaacacgaaaattatttaatttatagggtgtggatgttcaactattcactcattcttcgacagatccaataatccgattcattgaaaattgcaccgtaaacgacagaaagtgataactctcaacttttctcaaataatttttgaaaattctagaatttcgtctgaagaaattcccgatttttccactgctgcggcgaatattttcttggcggatatgaagagcttctctgagactgttgatttgagaattaacactgatacaacgatcttcaatgagaaaattgatatggtatttgtgctacaaagtttccaatacacaatgttctttcagattgttctgaaacatggtgcatcgattacaatcaatagaattgctcagacatctggtggttccacctcgccacctacattcgattaatttttaagtgttctcccagaaatcaggaaataaagtcttgacgtttaagaccaaaacacgaaaaacctttcatttttgttcgagcaacaagacaactgacgttgtttcgggtcacgagtagagatgggggtcctgactgataatcatcaacaaaatgccgtggattt