Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:311C3   

TH:311C3RNAiTH:311C3
PCR_productTH:311C3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK637.4 Source_evidenceePCR288WS150 Sequence/Annotation Release
Overlaps_Gene ZK637.3 Source_evidenceePCR279WS150 Sequence/Annotation Release
Chunk_score Abs_score258
Max_abs_score258ZK637.3
Specificity_index0.558
Rel_score1
Map_statusTop85_percentile_ePCRIII88938308894562
ZK637.4 Source_evidenceePCR288WS150 Sequence/Annotation Release
Chunk_score Abs_score204
Specificity_index0.442
Rel_score0.791
Map_statusBest_ePCRIII88938308894562
Overlaps_transcript ZK637.4 Source_evidenceePCR288WS150 Sequence/Annotation Release
ZK637.3 Source_evidenceePCR279WS150 Sequence/Annotation Release
WB_DNA_textTH:311C3733acgggttcccatcatttgtctctttttttgcatatttgaccttttgaagcttcatcctgtgtttagatttcccatttcgagctgtgattgcacgtcggagtatttttagagatcagctttaaatccgagttttccttgtttgaaaatagaaacattatttgaaaacaactgtaatatttattccacgtgaccccttaccctccatcactctctttataaactgaacagagactttttcgtttttttgacgaactattaaaataaaactttttgaattttttcctaatgaagtcaaatccaaaatattttctaatgaatgacgtggagcggcagagcaaatattcgccgaaatatgtgagttttcttcaaatttttgttaactttaacaaaaagtttccaatttcaggttccaaacaacagtctgaaagagcgaattctggagtttttggattattacattgcgccattgaaactgtaagtttcattttatggaaaattctcataaaaaactcaatattttcaggtatcttctgtcttacccgatgccggattgcctttgggacaatcgaaaattgaggtattacatcggaaaatcgttgcaatgacatggaacccacattcatttttttcagattgaaggccagtggtgtgcaagtgactccgagctccgaaccagttcatatcgatgatcgtctaattcacatttcacagaaacaaccgtccgaatgatttt