Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:311f4   

TH:311f4RNAiTH:311f4
PCR_productTH:311f4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF35G12.9 Source_evidenceePCR372WS150 Sequence/Annotation Release
Overlaps_Gene F35G12.11 Source_evidenceePCR132WS150 Sequence/Annotation Release
Chunk_score (3)
Map_statusBottom50_percentile_ePCRIII45936614594351
F35G12.9 Source_evidenceePCR522WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusBest_ePCRIII45936614594351
Overlaps_transcript F35G12.11.2 Source_evidenceePCR132WS150 Sequence/Annotation Release
F35G12.9 Source_evidenceePCR522WS150 Sequence/Annotation Release
F35G12.11.1 Source_evidenceePCR117WS150 Sequence/Annotation Release
WB_DNA_textTH:311f4691ctgatcttcatgtgctcgccggtcttttatttcttcttccttttcaatgattcttgctcaatttacaattcgatttcaattgcgatatttttatactttctgatgaatttctcactatgaatatttcaatttaaaaagtcttcgttcttgttaatttaaaatacaaatgaggaaaactgagtatcatttgacatgaaaaaatggaaacacaagataaaaacgtagattactctacaattgtccagtcttgtctgcaaagcgggcattgagctcttggttggttagttggtgctgcaatccacttatcgatgcaatgacgatgaaaagcatggcgacaaattcccagaaccaatgggcaatcatctcctggaaacttgcacatgttgcacgccgattcaaattccattcgacaaattccacaggtatcttcacctccttgtaaccacttccactctccacaaacctgaaaaatgtcaagtttttgaaacttcaattttttttgacaaactaacatgtaactttttgacggtaatgctcatccgagtgttggtttttaatagaatccctggatgatcatcctgcatctgaaaaccgaaatatgatacgaattatttcttatatgtcttacagtatgaagttcagaactgctcatcgacatattttgttgatcatcgtttccctgtgattcatc