Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:312E5   

TH:312E5RNAiTH:312E5
PCR_productTH:312E5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS B0336.13 Source_evidenceePCR420WS150 Sequence/Annotation Release
B0336.5a Source_evidenceePCR606WS150 Sequence/Annotation Release
B0336.5b Source_evidenceePCR615WS150 Sequence/Annotation Release
Overlaps_Gene B0336.13 Source_evidenceePCR501WS150 Sequence/Annotation Release
Chunk_score Abs_score480
Specificity_index0.499
Rel_score0.998
Map_statusTop50_percentile_ePCRIII56929625694599
B0336.5 Source_evidenceePCR690WS150 Sequence/Annotation Release
Chunk_score Abs_score586
Max_abs_score586B0336.5
Specificity_index0.501
Rel_score1
Map_statusBest_ePCRIII56929625694599
Overlaps_transcript (3)
WB_DNA_textTH:312E51638aatgagctccaatgacgttctcgcacaaattgccggtctggcgaaagctgcagcagaggtttgaaatttgaaattttaatgtatttaatttttgtatttttttcagcttgaaaatgatttctcgacggatagtgaaatgcaacaagattccgagatttgcgatgaagtcgatgcggagctttttgacgatttcgaaacaaaggtacgcttttgaataaagaaaattttaacaaagttcccagaagttgcagccatcatctcgaaaggaaagttcaggaacgagccgtcgaacgagaatggcacaccgagagcttcaaggcctccagttcgcgaatccaggagatgaaatgtctcgatttttgcccgactctgtggatattattagcaccaaccgctcgaaacgtgtagccgcggagaagcaggcggatctgagagacgaacctttgcatcatgacaaaacaggaaaactttcggttaccgcaaaaggacagactttgtttttcgatctttgtgattgtctcgtggtggagtgtgatgggtgccattggccatgtaagcagtgcaaatgtaagagatgatattcattaactaaaaatatttgttctaaaaattctttaaacaaagaaaaatgcatttttcagctcgcaaatgtctcatcggatgtcgtcaaaatcgaaaagaaatggtgatacgcgtcgaggagatgtacacagtgacggaagccccgggccctgttgtcaatattaatccttattttccgggccaaatcaaggattaaatgccttatcgttttatcaattttaacctcttatgtatgttcccctttttcttgtactggtattatctattttgaactgttttatacatgtctttgtgaaaaattcaatctcgatgttcattaaaaactaaagatattgtttgtttttgttcttttttgtcatactaatccatagtttctcggttgataatctgaaaatatatctggcatcttctcgagaaaaatttaatccaacgatatttcagaatcttccagaaatgtcgtcatacgctctttaccgagggaccacactgggtcaggcactcgataaaactcttgaggacatggaatccgaaggacttctcacgaaatctcttgcttcgaaagttctgcaacaatttgataaaagcatgaacaagcaaatctcgcggcttccaaaagagaaaatgaatttttgtgcgacacaactgctcacttatcgatattgtgataacgtttggacgtttattctcaataatgtcacgttgaaagatccccagcgatcgtttgatgagcctattgataagtgagtgtttcttttatttgtattaaaaataaaaaatctagaaaaaagcaattgtttattaattttctataaaaatttttgtttctcgatgatctataattattaatatttcagactgaaagtggtcgcctgtgatggtcgtcaaacaagccttctgcagacattgagcgcccagggaccatccaagagagtcaatcgagctcacgcggccgctgcaggcgacgatgaagatgatgacagtgattagatgaactttccaaatcattgtttcattttctaatccaatttcttctcttacacaagctttctattgtat