Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:312G10   

TH:312G10RNAiTH:312G10
PCR_productTH:312G10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC35D10.8 Source_evidenceePCR395WS150 Sequence/Annotation Release
Overlaps_Gene C35D10.8 Source_evidenceePCR404WS150 Sequence/Annotation Release
Chunk_score Abs_score348
Max_abs_score348C35D10.8
Specificity_index0.851
Rel_score1
Map_statusBest_ePCRIII48550254855880
C35D10.9 Source_evidenceePCR103WS150 Sequence/Annotation Release
Chunk_score Abs_score61
Specificity_index0.149
Rel_score0.175
Map_statusBottom50_percentile_ePCRIII48550254855880
Overlaps_transcript C35D10.9a Source_evidenceePCR103WS150 Sequence/Annotation Release
C35D10.8 Source_evidenceePCR404WS150 Sequence/Annotation Release
WB_DNA_textTH:312G10856aaatttcagatctatcccaaatgttcttaaatttaatgttttctacagatactcaacacatcttgtttcatctcatccttgcttttttttttcaaatatattcagtttcttttataattttaattaatcgaattaatacattcacgtaaagaatttcgtggactattattttatcgcatccaaatgatttattccctattgttcgaaacttccaaattgatcatttttaaacacgcctcattaaattgaaagtcgtacttttagtctcgaacatgaagtaagttattttctgtgttctaaattcaaagtgcattccaaaaggacatttgatgagttttcacgaaaaccgtaatttttacaatttcctttcagttttgaagatgttcgatttctttcctctgttggcgtcattactacatttgctttgctgcttcactttatcgagattcttgccatcaatggagttccatctagaccgatagcagtcttcatatcattatccctgtatattgtactgtttcagtattttaacttatcgattacgtactattttcagtggttcactgttttcggtcaatgggtgacacgtgctcgacgagcaattttcaacgaacgcaatctcctagtcacttatcaaccaagagccctcacccatggacatctctttgtggtatttgcatgattcaacgaagttttagtcttaagattcatgatttcagccagatccgccgacgccttgtcgtctgtccattacaccatgtgaatcgggaagtgacacggagttcaagaatgcacgggatgctcattacaaagatgaatttcatagagcgattaaaatggcaaacgaacgactagt