Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:312c9   

TH:312c9RNAiTH:312c9
PCR_productTH:312c9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06H7.6 Source_evidenceePCR874WS150 Sequence/Annotation Release
Overlaps_Gene K06H7.6 Source_evidenceePCR874WS150 Sequence/Annotation Release
Chunk_score Abs_score769
Max_abs_score769K06H7.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII80824758083529
Overlaps_transcriptK06H7.6 Source_evidenceePCR874WS150 Sequence/Annotation Release
WB_DNA_textTH:312c91055cctggacttgctgaaactgagattccaatacagtgagctacaacattgtgaagtgatgcttcgggacgttattcatagtctcgatattgataaaaagtttgaagacatgagtgaaagaagcgctggaaattatgatgttccgattattccaatttctgcatgtatcatctcaagtcattattggccaaagttggaaactgaaaaaacagaagcggtgagaatattgcaacaatgttacaatatgaaaaattatttcagttaatgcctcaaccattgcaagctgcgatggacgtttaccaagaaacttatctggacgtgaagcgcgacagaaaattagaatggttaagaagtgttgggtaagtttcatttgttgaattatcatgtgaattttaactttttaaagatgtgtagaggtttctatcaatatcgatggagttgaagtagatcgaacaattccaaatatgtacgctcttctcctcttcttgttcctcgaaaaagaaacatggacaactgctgaagtagtcgagaaaatgggaatgtcagtggttgtgacaagaaaacgattggaatggctggttaaacaaggatttatttgcatggtaaaatagaaaattattaagttatcatataatttcattctcagaatcccattatcagtagcgacacgtggacattgacccggaatccaagtggaatttccatcgttcgaccaggcacaccggaccttgaagacgatgaagatgtggaaccggaagagaattctgatatggttgatgctttagaacaatattggggatatactagaaatttcattgtaagtaaaacttaaaatatataagaataaaaaaatcaattttcaggccaatcatgcacctaacggagaagtgaaagcggaacggatgcatcgtgtctaccgtatgttcggttctccaacttctgcaggacccactcttgatcatgtttccgcgtttttgcaaagaaaagttgcgctgggactgctaacctgcattaatgggtcatatcgtatcattcaggaaaagaaagacggcgaataa