Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:314A10   

TH:314A10RNAiTH:314A10
PCR_productTH:314A10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK637.3 Source_evidenceePCR963WS150 Sequence/Annotation Release
Overlaps_Gene ZK637.3 Source_evidenceePCR963WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII88916088893289
Overlaps_transcriptZK637.3 Source_evidenceePCR963WS150 Sequence/Annotation Release
WB_DNA_textTH:314A101682tgaccaaagaaagcgatggatcacttttcatgagtgtaagtctattttaacagtagtagtttgaaatgcaatatatttttcaggtttggcaaaagacaaaaatcagctggcaatttagagattgggttcctaaattgactccagcacaatatccattcgttggtgctccagttgttatggatgttgattcggacggtgaactcgacattctagtaccaatctgccgtgaagatgagtgctcacacattactcaaatggcttcttggtcgaagactaaactttggggattggtggcctgtgatatgcaagattatacagttattaaagaaccattttcacgagttatattccgcgttggagaattctcgttggacagtttccctgatatggtggttattgcgcaggcaaccagagtgagtttaacaatttttattttaaacaggatgtggttgtatacttttaaaaaatgttctatggcttgataaggcgttatgtatatctgattctttaaaagttccaaaaatcaacctcttcgtctattgaatttgaatttcgatttttaattttctttgagttttgtaagaaacgcggccgtgtactcttctcggacaattaactaattaaatttttggatttcaagtaatttttcgcattttcttgatttccctcggtatgttgtaacagatgcagagacgcattttactttaattaacagaccactcactcctaaatacagtaatgtatcttgttctgctgatgaatgacacttctaaaatcacatagtttattcattttcctgtttttcattgaataatcaatttgatagtgttatcgattttcattagaaataacgggaagtaacgagaaaatactaggacatggcctaaaattcaaaaatttaattaattaatagtacgagaagagtaaaaataggaagatcagacttgatttcccaaaaataacttcagttaactgaataatgcaaaaaaaattacctttcattaatcaaaatttgaataatttcaggccaacactcgccctgtgatcaaagtaatggacaatgcagaatgtacaaaatgtgaaaagaacggaacacgacgattcgaaatccgagctcaagagaatattcaaccaaaaaatatgtctctcggagtcatcaaaatgggaacattttttgatcttcttgaagatggatcattggatcttcttgttgagtatgaatacggtggtcagacacgttttggattcatctactgccctgataaaggagatacaacattcttgaaagttcaagttttcacaggagtttgcagtgatcgatgcaatccaaaatcaaacgagattggatcgagtatcagtatgactggtgcatgtgcttctttctcaatgacagatggatggggaggtagtacacagagtgtagcatgtcaagttccggcttcatcaaatagagcactttatctcccatttttgttgtatggtcttggaagaagtccaaattttgtggatgaggtaatttcatatcttctagatattttcgttcaattattccaaataatctttttttcagttgaatattgccattccgaaatacgcagatcgtaaagaagattggaaacacagtcttaaacagattgttccaaattctcggattattgttctcccaccatcggatcaatatc